Skip to main content

Table 4 Primers used for qRT-PCR

From: Transcriptome analysis reveals differential immune related genes expression in bovine viral diarrhea virus-2 infected goat peripheral blood mononuclear cells (PBMCs)

Gene Name Forward primer 5′-3′ Reverse primer 5′-3′
TNF TCGTATGCCAATGCCCTCA GATGAGGTAAAGCCCGTCAGT
GM-CSF GACACTGCTGCTGTGATGAA CCCTGCTTGTACAGCTCCA
IL-6 TGGATGCTTCCAATCTGGGT CTGCTCTGCAACTCCATGAC
IL-10 ATGGGCCTGACATCAAGGAG ACTCTCTTCACCTGCTCCAC
IL-12B AAACCAGACCCACCCAAGAA TGAGGTTTGGTCCGTGAAGA
IL-17A TCTGAGTCTGGTGGCTCTTG TGGAGTTCGTGTTCCGGTTA
CCL2 CGCTCAGCCAGATGCAATTA GTCCTGGACCCATTTCAGGT
CCL3 CCTGCTGCTTCTCCTATGC TGGAAGATGACACCAGGCTT
CCL4 TCCTCGCAGCTTTGTGATTG TCAGTTCGAGGTCATCCATGT
CCL5 CCATGGCAGCAGTTGTCTTT CACCCACTTCTTCTCTGGGT
CCL20 CTCCTGGCTGCTTTGATGTC ATGTCACAGGCTTCATTGGC
CXCL10 ATACACGCTGTACCTGCATC TGTGGCAATAATCTCGACACG
SAA ATCACAGACCCTCTGCTCAAG CCATTCGTTGGCAAACTGGT
NFKBIA CCTTCAGACACTGCCAGAGA CTCCAAGCACACAGTCATCG
Beta-Defense ACCTTCTCTTTGCGTTGCTC CGTAACCCGCTTATGATGCC
ANXA2 CACACCTCCAAGTGCATACG ACCTCATCCACACCTTTGGT
ANXA3 AACGGCAGCTGATTGCTAAG GGCTACCATGAGACCCTTGA
ANXA4 TGAGGGCTGCTTGATTGAGA GCCCATATTGCAGCTGGTAG
GAPDH ATGATTCCACCCACGGCAA ATCACCCCACTTGATGTTGGC