Skip to main content

Table 2 Primers used for gene expression studies by qPCR analysis

From: The initiation of puberty in Atlantic salmon brings about large changes in testicular gene expression that are modulated by the energy status

Gene description Target gene Primers Primer sequence (5′ → 3′)
Anti-Müllerian hormone amh Fw CAGTCACTCTCTGCAGCCTTACAA
Calreticulin precursor calr Fw ACGCCGCTGACTCTACCATCT
Catenin beta-1 ctnnb1 Fw CCCCAGGCGACAGCAAT
Cryptochrome-1 cry1 Fw AGGTCAGCCGGCCAACA
Endoplasmin precursor hsp90b1 Fw TGAAGCGGATTTGGTTTATTGG
Eukaryotic 18S ribosomal RNA 18S TaqMana proprietary information
Follicle stimulating hormone subunit beta fshb Fw TCACGGAGGCATCACCATCA
Frizzled-8 precursor fzd8l Fw GGAGCGACCCATTATTTTCCT
G1/S-specific cyclin-D1 ccnd1 Fw AAGCAAATCCTGTGCAAGCA
Gamma-crystallin M2 crygm2 Fw CCACCTTCTACGAGGACAGGAA
Gap junction alpha-1 protein gja1 Fw CCTAAGGGCTCTCTTCTTACTTCTGA
Gonadotropin releasing hormone receptor 4 gnrhr4 Fw TCAACCCACTGGCGATCAAT
Gonadotropin subunit beta-2 lhb Fw ACACTGCCCATCAGGACACAA
Growth-regulated alpha protein-like LOC106577834 Fw TCATCATGAATACTGCAATGACTGTT
Insulin-like 3 (Leydig cell) insl3 Fw CTCCGGAGCTTGGACAACAC
Insulin-like growth factor 3 igf3 Fw GACCGACCGACAAGATGCA
Olfactomedin-like protein 2B precursor olfml2b Fw CGAAGGGCAACGGAAATGTA
Prostaglandin E synthase 3 ptges3 Fw CCGTGGCTGAGGCTAACAAA
Vasotocin-neurophysin VT 2 precursor neu4 Fw GGACACTGCGCTGCAACA
Wnt-11 precursor wnt11l Fw CCCCAGGCCAGCACACTA
  1. a20X eukaryotic 18S rRNA pre-developed TaqMan assay (4352930E; Applied Biosystems). Fw Forward, Rv Reverse