Skip to main content

Table 4 Exemplified tissue-specific MTIs in different tissues

From: Construction and analysis of degradome-dependent microRNA regulatory networks in soybean

Category miRNA Target miRNA_seq Tissue miRNA_type Target_Annotation
Cat_1 gma-miR159b-3p Glyma.04G125700 ATTGGAGTGAAGGGAGCTCCA Cotyledon non-changed myb domain protein 33
Cat_1 gma-miR159e-3p Glyma.06G312900 TTTGGATTGAAGGGAGCTCTA Cotyledon Leaf-specific myb domain protein 65
Cat_1 gma-miR159e-3p Glyma.04G125700 TTTGGATTGAAGGGAGCTCTA Cotyledon Leaf-specific myb domain protein 33
Cat_1 gma-miR159a-3p Glyma.06G312900 TTTGGATTGAAGGGAGCTCTA Cotyledon Leaf-specific myb domain protein 65
Cat_1 gma-miR159c Glyma.04G125700 ATTGGAGTGAAGGGAGCTCCG Cotyledon non-changed myb domain protein 33
Cat_1 gma-miR159f-3p Glyma.06G312900 ATTGGAGTGAAGGGAGCTCCA Cotyledon non-changed myb domain protein 65
Cat_1 gma-miR1508c Glyma.09G256500 TAGAAAGGGAAATAGCAGTTG Leaf non-changed Pentatricopeptide repeat (PPR) superfamily protein
Cat_1 gma-miR1508c Glyma.16G139800 TAGAAAGGGAAATAGCAGTTG Leaf non-changed Tetratricopeptide repeat (TPR)-like superfamily protein
Cat_1 gma-miR1508c Glyma.16G165400 TAGAAAGGGAAATAGCAGTTG Leaf non-changed Tetratricopeptide repeat (TPR)-like superfamily protein
Cat_1 gma-miR1508c Glyma.12G118300 TAGAAAGGGAAATAGCAGTTG Leaf non-changed ATP binding;nucleic acid binding;helicases
Cat_1 gma-miR1508c Glyma.16G162800 TAGAAAGGGAAATAGCAGTTG Leaf non-changed rna processing factor 2
Cat_1 gma-miR1508c Glyma.09G256600 TAGAAAGGGAAATAGCAGTTG Leaf non-changed Pentatricopeptide repeat (PPR) superfamily protein
Cat_1 gma-miR5674b Glyma.09G171200 TAATTGTGTTGTACATTATCA Leaf non-changed ATP binding;nucleic acid binding;helicases
Cat_1 gma-miR1508c Glyma.16G160700 TAGAAAGGGAAATAGCAGTTG Leaf non-changed rna processing factor 2
Cat_1 gma-miR1508c Glyma.16G162700 TAGAAAGGGAAATAGCAGTTG Leaf non-changed rna processing factor 2
Cat_1 gma-miR1508c Glyma.16G162000 TAGAAAGGGAAATAGCAGTTG Leaf non-changed Pentatricopeptide repeat (PPR) superfamily protein
Cat_1 gma-miR5674a Glyma.09G171200 TAATTGTGTTGTACATTATCA Leaf non-changed ATP binding;nucleic acid binding;helicases
Cat_1 gma-miR2109-5p Glyma.16G085900 TGCGAGTGTCTTCGCCTCTG Root non-changed Disease resistance protein (TIR-NBS-LRR class) family
Cat_1 gma-miR1510b-3p Glyma.U008300 TGTTGTTTTACCTATTCCACC Root non-changed Disease resistance protein (TIR-NBS-LRR class) family
Cat_1 gma-miR1510b-3p Glyma.16G118600 TGTTGTTTTACCTATTCCACC Root non-changed disease resistance protein (TIR-NBS-LRR class), putative
Cat_1 gma-miR164e Glyma.12G226500 TGGAGAAGCAGGGCACGTGCA Seed non-changed NAC domain transcriptional regulator superfamily protein
Cat_1 gma-miR164e Glyma.06G236000 TGGAGAAGCAGGGCACGTGCA Seed non-changed NAC domain transcriptional regulator superfamily protein
Cat_1 gma-miR164a Glyma.13G274300 TGGAGAAGCAGGGCACGTGCA Seed non-changed NAC domain transcriptional regulator superfamily protein
Cat_1 gma-miR164c Glyma.06G236000 TGGAGAAGCAGGGCACGTGC Seed non-changed NAC domain transcriptional regulator superfamily protein
Cat_1 gma-miR164c Glyma.12G161700 TGGAGAAGCAGGGCACGTGC Seed non-changed NAC domain transcriptional regulator superfamily protein
Cat_1 gma-miR164k Glyma.12G226500 TGGAGAAGCAGGGCACGTGCA Seed non-changed NAC domain transcriptional regulator superfamily protein
  1. Terms in ‘Tissue’ describe which tissue the MTI specifically occurs