Skip to main content

Table 4 Unique miRNA mature sequences present on the floral transcriptome of sexual and apomictic P. notatum

From: Small RNA-seq reveals novel regulatory components for apomixis in Paspalum notatum

miRNA mature sequence nt Accession* Pn Os Sb Si Family
GCUCACUUCUCUUCCUGUCAGC 22 MIMAT0015124 0 0 0 1 miR156
GCUCACUUCUCUCUCUGUCAGU 22 MIMAT0015129 0 0 1 0 miR156
GCUCACUGCUCUGUCUGUCAUC 22 MIMAT0015128 0 1 1 1 miR156
UUGACAGAAGAGAGUGAGCAC 21 MIMAT0026186 0 1 0 0 miR156
UUUGGAUUGAAGGGAGCUCUG 21 MIMAT0001023 0 1 1 1 miR159
UGCCUGGCUCCCUGUAUGCCA 21 MIMAT0000178 1 0 2 2 miR160
UGGAGAAGCAGGGCACGUGCA 21 MIMAT0000185 0 1 1 1 miR164
UGGAGAAGCAGGGCACGUGCU 21 MIMAT0001034 0 1 1 1 miR164
CAUGUGCCCAUCUUCUCCACC 21 MIMAT0015138 0 1 0 0 miR164
CACGUGCUCCCCUUCUCCACC 21 MIMAT0015319 0 1 0 0 miR164
UCGGACCAGGCUUCAUUCCUC 21 MATAT0001072 0 1 1 1 miR166
UCGGACCAGGCUUCAUUCCCC 21 MIMAT0000189 0 5 5 5 miR166
UCGGACCAGGCUUCAAUCCCU 21 MIMAT0001037 0 1 2 2 miR166
UGAAGCUGCCAGCAUGAUCUGA 22 MIMAT0014072 1 1 1 0 miR167
UGAAGCUGCCAGCAUGAUCUA 21 MIMAT0000196 0 1 1 2 miR167
UCGCUUGGUGCAGAUCGGGACC 22 MIMAT0001045 0 1 1 1 miR168
UGGGCGGUCACCUUGGCUAGC 21 MIMAT0026431 0 0 1 1 miR169
UUGAGCCGCGUCAAUAUCUCC 21 MIMAT0014082 0 1 1 1 miR171
GGAUAUUGGUGCGGUUCAAUC 21 MIMAT0022877 0 1 0 0 miR171
GUGGUAUUGUUCCGGCUCAUG 21 MIMAT0037190 0 1 1 1 miR171
UUGGACUGAAGGGUGCUCCCU 21 MIMAT0020761 0 1 1 1 miR319
AAGCUCAGGAGGGAUAGCGCC 21 MIMAT0000931 0 1 0 0 miR390
UCCAAAGGGAUCGCAUUGAUC 21 MIMAT0000957 1 1 1 0 miR393
GUUCUCCUCAAGCACUUCACA 21 MIMAT0015347 0 1 0 1 miR395
UCCACAGGCUUUCUUGAACUG 21 MIMAT0001601 0 0 0 1 miR396
UUCCACAGCUUUCUUGAACUG 21 MIMAT0000944 2 1 1 1 miR396
UUCCACAGCUUUCUUGAACUU 21 MIMAT0000945 0 1 0 1 miR396
UUGAGUGCAGCGUUGAUGAGC 21 MIMAT0025996 0 0 1 1 miR397
UGUGUUCUCAGGUCGCCCCCG 21 MIMAT0014020 0 0 1 0 miR398
UGCCAAAGGAGAGUUGCCCUG 21 MIMAT0000952 0 0 1 1 miR399
UGCCAAAGGAGAGCUGCCCUG 21 MIMAT0000992 0 1 1 1 miR399
UGGAAGGGGCAUGCAGAGGAG 21 MIMAT0014028 0 1 1 1 miR528
AGAAGAGAGAGAGUACAGCCU 21 MIMAT0014030 0 1 1 1 miR529
UGGGUGUCAUCUCUCCUGGAGC 22 MIMAT0015366 0 0 1 0 miR1432
UUCCCGAUGCCUCCCAUUCCUA 22 MIMAT0011741 0 0 1 0 miR2118
UUCCUGAUGCCUCCCAUUCCUA 22 MIMAT0011745 0 0 0 1 miR2118
UUUGGUUUCCUCCAAUGUCUCA 22 MIMAT0035533 0 0 0 1 miR2275
CUUGUUUUCCUCCAAUGUCUCA 22 MIMAT0037125 0 1 0 1 miR2275
CUUGGUUCCCUCCAAUAUCUCA 22 MIMAT0011758 1 0 0 0 miR2275
AGGAUUAGAGGGAACUGAACC 21 MIMAT0011769 0 1 1 1 miR2275
CUCUCGCCGGCGUGCGCACUCC 22 no hit 0 0 1 0 Pn_miR1
AGUGCGCCGCCGUCGAUCUGC 21 no hit 1 0 0 0 Pn_miR2
UUGACAGAAGAGAGCGAGCAC 21 no hit 0 0 1 1 Pn_miR3
UGACAGAAGAGAGUGAGCAC 20 no hit 1 0 2 1 Pn_miR4
UGACAGAAGAGAGAGAGCAC 20 no hit 0 0 1 1 Pn_miR5
GGGCAAAUCAUCUGGGCUACC 21 no hit 0 0 0 1 Pn_miR6
UGAGCCGAGCCAAUAUCACUUC 22 no hit 0 1 1 1 Pn_miR7
UAUUGUCUCGGCUCACUCAGA 21 no hit 0 1 2 2 Pn_miR8
  1. Sequences were detected by using four references: Pn: Paspalum transcriptome; Os: Oryza sativa Japonica genome; Sb: Sorghum bicolor genome; Si: Setaria italica genome
  2. *Accession number was obtained by performing BLASTn analysis (SSEARCH option) of mature sequences on miRBase [48]