Skip to main content

Table 1 QRT-PCR primers used in verification of microarrays results

From: Microarray analysis of infectious bronchitis virus infection of chicken primary dendritic cells

Gene Sence Anti-sence
Leukocyte transendothelial migration
 ITK tggaagaagaaggccccaat catcgctccttcacgaatgg
 NFATC2 cagcatcaaaccccatcgag atctgctgcccatctgaagt
 PIK3R5 gcacttcctaccattgcagg tcctcctcctcctcttcctc
 PLCG2 gctttgtggctctcagatgg agcttagggagatgacgagc
 CXCL12 gatgcccctgtcgattcttc tcctggatccattttagcttgg
 ZAP70 tatggagctacggtgtgacc aggtgcggattgtgttttcc
 MYL12A caatggcactgatccggaag tccatgtttaaggatgcgcg
 CLDN1 ctgtctttggtggcgtgatc taggatgtttcactccgggg
 VCAM1 gagaaaccgccactgtcatc tctggccacacaaacaatctc
 MLLT4 taattcctccccagcctgtg gtactgcagatctctccgct
 THY1 ccaaggacaacaggaagcac ccttcagctcgcacatgtag
 IL6 acgtcgagtctctgtgctac ggcactgaaactcctggtct
 NCF2 cacggagggagagggatttt cattgcccttccaaccagtc