Skip to main content

Table 2 Primers for RT-qPCR in this study

From: RNA-Seq based transcriptome analysis during bovine viral diarrhoea virus (BVDV) infection

Name Primer sequence Name Primer sequence
C8orf4-F CCATCCACGGCTACCACTTC GATM-F CATTGGGCCTGGTCTTGTG
C8orf4-R AGCCTCTGTAATGCTTCTTGGTCTA GATM-R ATGGTCCATCCTGCTTTCTTGA
PSPH-F TCAAGGCTGCCCTCACACA IFITM1-F CTACCGCCAAGTGCCTGAA
PSPH-R AGGAGCCTCTGCACCTGTTC IFITM1-R AATGAGAAGAACGATCGATCCAA
ISG15-F TCGCCCAGAAGATCAATGTG HMGCS1-F GGCTCCCTGGCTTCTGTTC
ISG15-R AGCACCTCCCTGCTGTCAAG HMGCS1-R AGAAAACACGCCGATCCTCTT
EGR1-F GGCCGAGATGCAGCTGAT INSIG1-F CCTCGCCACCCTGATCAC
EGR1-R TGTCCATGGTGGGCGAAT INSIG1-R CACGCCTCCCGAGAAGAAG
SIGLEC10-F CAGCTTACGGCTTCTGGTTCA ACSS2-F CCGTCTGCTCATGAAGTTTGG
SIGLEC10-R TTGTGTCCACGTCCTGATCTG ACSS2-R TTGATAGGTTCGCCCACAGTT
FABP3-F GACAGGAAAGTCAAGTCCATCGT HMGCR-F CTGCTGCTGGTCGACCTTTC
FABP3-R CCCGCACAAGTGATGTCTCTT HMGCR-R TCTCCCTCACTTCATCCTGTGA
GRIP2-F CCTGGTCATCTCCGACATCAA LPIN1-F TGTTCAGTGTCACCACGCAGTA
GRIP2-R ATTTGCACAGCGTCCTCCAT LPIN1-R GGTCCCATCAATGTCAGAGATGA
GALNT18-F GTGCCGCAACCTCTCGTT ACLY-F CCAGAGGTAGACGTGCTAATCAAC
GALNT18-R CACGGAGAGTGCTTCATTGACA ACLY-R TGAGCGTAATTCATGGTCTCCAT
β-actin-F TCAGCAAGCAGGAGTACGATGA β-actin-R ATCCTGAGTCAAGCGCCAAA