Skip to main content

Table 6 Sequences of wheat 1DS and 1DL SSR markers

From: Characterization of a wheat–tetraploid Thinopyrum elongatum 1E(1D) substitution line K17–841-1 by cytological and phenotypic analysis and developed molecular markers

MarkerPrimer sequence (5′-3′)Annealing temperature (°C)Arm locationAmplification size (bp)
wmc147F: AGAACGAAAGAAGCGCGCTGAG
R: ATGTGTTTCTTATCCTGCGGGC
581DS154
wmc222F: AAAGGTGCGTTCATAGAAAATTAGA
R:AGAGGTGTTTGAGACTAATTTGGTA
541DS184
gwm337F: CCTCTTCCTCCCTCACTTAGC
R: TGCTAACTGGCCTTTGCC
591DL191
Xcfd63F: TCCTGAGGATGTTGAGGACC
R: GAGAGAGGCGAAACATGGAC
581DL282
  1. F forward primer, R reverse primer