Skip to main content

Table 5 Characteristics of AS-PCR primers for ScGAMYB identification in rye, differentiating rye inbred lines used as parental components of three mapping populations: BSR-F2 (S32N/07 × RXL10), RIL-K (541 × Ot1–3)), and RIL-L (DS2 × RXL10)

From: The GAMYB gene in rye: sequence, polymorphisms, map location, allele-specific markers, and relationship with α-amylase activity

Common primer AS primer designed to 541 line sequence AS primer designed to Ot1–3 line sequence SNP position (cds / exon 3 fragment) Product size (bp)
Name Sequence Name Sequence Allele presented in line Name Sequence Allele presented in line
31F20 catcaggcgacgcagtgctc 541.285R20c ccgtcagtgaaatcggagtc 541, DS2, S32N/07 Ot.285R20g ccgtcagtgaaatcggagtg Ot1–3 1100/485 274
541.275R20g aatcggagtstgcgtcgccg 541, DS2 Ot.275R20c aatcggagtctgcgtcgccc Ot1–3 1110/495 264
17F21 ggagagctgaaaaacatcagg 541.285R20c ccgtcagtgaaatcggagtc 541, DS2, S32N/07 Ot.285R20g ccgtcagtgaaatcggagtg Ot1–3, RXL10 1100/485 288
541.275R20g aatcggagtstgcgtcgccg 541, DS2 Ot.275R20c aatcggagtctgcgtcgccc Ot1–3, RXL10 1110/495 278
583R24 cggtcgatcagttctcaaatgact 541.266F20c gctgttcctcggcgacgcac 541, DS2, S32N/07 Ot.266F20g gctgttcctcggcgacgcag Ot1–3, RXL10 1100/485 341