The GAMYB gene in rye: sequence, polymorphisms, map location, allele-specific markers, and relationship with α-amylase activity

Table 5 Characteristics of AS-PCR primers for ScGAMYB identification in rye, differentiating rye inbred lines used as parental components of three mapping populations: BSR-F₂ (S32N/07 × RXL10), RIL-K (541 × Ot1–3)), and RIL-L (DS2 × RXL10)

Common primer		AS primer designed to 541 line sequence			AS primer designed to Ot1–3 line sequence			SNP position (cds / exon 3 fragment)	Product size (bp)
Name	Sequence	Name	Sequence	Allele presented in line	Name	Sequence	Allele presented in line	SNP position (cds / exon 3 fragment)	Product size (bp)
31F20	catcaggcgacgcagtgctc	541.285R20c	ccgtcagtgaaatcggagtc	541, DS2, S32N/07	Ot.285R20g	ccgtcagtgaaatcggagtg	Ot1–3	1100/485	274
31F20	catcaggcgacgcagtgctc	541.275R20g	aatcggagtstgcgtcgccg	541, DS2	Ot.275R20c	aatcggagtctgcgtcgccc	Ot1–3	1110/495	264
17F21	ggagagctgaaaaacatcagg	541.285R20c	ccgtcagtgaaatcggagtc	541, DS2, S32N/07	Ot.285R20g	ccgtcagtgaaatcggagtg	Ot1–3, RXL10	1100/485	288
17F21	ggagagctgaaaaacatcagg	541.275R20g	aatcggagtstgcgtcgccg	541, DS2	Ot.275R20c	aatcggagtctgcgtcgccc	Ot1–3, RXL10	1110/495	278
583R24	cggtcgatcagttctcaaatgact	541.266F20c	gctgttcctcggcgacgcac	541, DS2, S32N/07	Ot.266F20g	gctgttcctcggcgacgcag	Ot1–3, RXL10	1100/485	341

ISSN: 1471-2164