Skip to main content

Table 7 Position of genes analyzed in the reference genome EquCab3.0, primer sequences and PCR annealing temperatures

From: Genetic diversity, evolution and selection in the major histocompatibility complex DRB and DQB loci in the family Equidae

Gene Position of the gene analyzed (EquCab3.0) Strand Amplification details Forward primer Reverse primer Annealing T (°C) PCR product lenght (bp)
TNFA 32,223,398.. 32,226,182 + TNFA_5UTR CCTTTCAGAAGACCCATCCA CATCTCGGATCATGCTTTCA 59.9 777
    TNFA_1CR TAAACAGCCAGGCGATTTTCTCCCT CCTACAACATGGGCTACAGGCTTG 57.5 1144
    TNFA_2CR TGCCTTCCAGTCAATCAACCCTCT GGTCACACATCCCTGCATTCTAGGTT 61.5 1192
    TNFA_3UTR TGAGCCCATCTACCTGGGAGGAGT GCAGAGGTTCAGCGATGTAGCGA 59 868
DRB1 33,625,487.. 33,631,729 1st round GGGACGTGTTTAAGATGGGT AACCACACACCCTCTCCACTG 7x(62–0,3/cycle) followed by 60 812
    2nd round TGACCGGATCCTTCCTGTAC GCGCTCACCTCGCCGAC 60 303
DRB2 34,096,675.. 34,108,525 + 1st round TGTCCTTCAGGTGGAGGCAA TCACACACTGACAACCACACATT 65 793
    2nd round TGACCCGATCSTTCCTGTAT RCGCTCACCTCGCCGAG 13x(65–0,3/cycle) followed by 61 303
DRB3 34,266,651.. 34,285,281 + 1st round ACTCGCTCACAGTCCTACACAC GTGCTGGTAGTTCGTGCGTGG 65 532
    2nd round TGACCGGATCCTTCCTGTAC GCGCTCACCTCGCCGAT 13x(65–0,3/cycle) followed by 61 303
DQB1 33,812,679.. 33,820,407   CCTCTGGGGTAACGTTCCAG CGGCCTTGCTTTAGGTTTATC 4x(63–0,5/cycle) followed by 61 590
DQB2 33,941,932.. 33,956,144   AGGTTTCTCCCACTCAACTGCCTGA GGACGCGCCCACCTCCCTGTCC 66 522
DQB3 34,031,398.. 34,037,071   AGGTTTATCCGATCCAACCGGCTGC GCCCTCCCAGCTCCGAGACT 4X(68–0,5/cycle) followed by 66 451
DQB2-like unknown unknown   GCTCTCCTGGCGCAGAGACT ACAGGGCTCTCATTTCCTTGTA 65.5 603
     GGTCAGAGCGGGAGGCGAGT GCCCCATAAGCTTCGCAGCA 64 902