Skip to main content

Table 3 Selected genes used for qRT-PCR

From: Transcriptomic analysis of flower induction for long-day pitaya by supplementary lighting in short-day winter season

Gene IDFunctionForward primer (5′ → 3′)Reverse primer (5′ → 3′)
NL vs L0
 unigene0031426Cycling DoF factor 1GAGCAAGGAGAATGGGGATGAGCAAAATGGCGGAACAGGAA
 unigene0025406Zinc finger protein CONSTANS-LIKE 2TTTTGTTCGGGATGGAGTCTGATTGGGTGGGAATTTGAATAGG
 unigene0019970HEADING DATE 3A-likeGGCAACCCAACTGAGCGAGAAGCCATCCCATTTGCTGACGA
 unigene0045107Response regulator-like APRR5AAGACCGCACCCACTTTTCCCATTCCCACTATCAGACCCACC
NL vs L1
 unigene0026114Cycling DoF factor 3-likeGGTCGTCGCAAGAGTAAACACTATAAAGCGGGCTATCAGG
 unigene0027129CONSTANS-LIKE 15TGGGAAGAAGCACCACCTCAAGCGGGCACCACGGAATAA
 unigene0028118CONSTANS-LIKE 4GCTTTTCGGCGACGACTATTATGAAGTCCAGTTCCAGGTAGGG
 unigene0036436Circadian clock associated 1CCTCAAGATCCCCTAATCACGCCCAAAAGGAAGCCGCAAAAC
 unigene0049229Circadian clock associated 1CCAAGCATGGCAGCGATAGGCTGGTTGAGTTTGGGTAAGAT
 unigene0005649Flowering locus TAGTGGAGATCGGAGGTGATGGCCTTGGATTCTCGTAGCA
 unigene0002396Phytochrome BGGTCTATTCCTTTCCCACTTCGAGAGAGCTGCTCCATCGCACT
 unigene0009351Transcription factor TCP4CACTGGAGGAGGTGGATTTATGGGATTGAGGGTGCGTTGC
 unigene0005880Transcription factor TCP15GGCGGTGGTGGATTTGACGCCCGACCTGTTTACCTGA
  1. NL control group (no light, no flowering), L0 stage of no flowering under light treatment, L1 flower bud stage under light treatment