Skip to main content

Table 6 Nucleotide sequences of the primers

From: Transcriptome sequencing and metabolome analysis of food habits domestication from live prey fish to artificial diets in mandarin fish (Siniperca chuatsi)

Primers for real-time PCR Sequences(5′-3′)
RPL13A-F CACCCTATGACAAGAGGAAGC
RPL13A-R TGTGCCAGACGCCCAAG
EZH1-F AAAAGATTGAGCAGCAGACA
EZH1-R GGAAGCCAAACTCCACTGTA
TFIIF-F GTGCCCAAATACCTCTCTCAGC
TFIIF-R TCTATACCCTCAATCACAGTCAGC
Primers for BSP amplicon Sequences(5′-3′)
BSP TFIIF-F TTTAGGGTTTTGATTTTGGTTTTTT
BSP TFIIF-R ACTAAATAAACAACTCTTCATTTTAC