Skip to main content

Table 3 qPCR primer sequences of eight genes

From: Metabolome and transcriptome profiling reveals anthocyanin contents and anthocyanin-related genes of chimeric leaves in Ananas comosus var. bracteatus

Gene Name and ID F Primer (5′-3′) R Primer (5′-3′)
PAL (Aco020618.1.path1) TGAAGTCCGCCGTCAAGA GCTCCTCCCTAACGAACCTGTA
CHS (Aco016200.1.path1) GTGCCGCTGCTGTTATCC TGTTCCCGAACTCGCTCA
CHI (Aco012547.1.path1) GATTCCTTCTTTGAGGCACT GTTTGGAAAAACTCGGCAAT
F3′H (Aco003857.1.path1) GGGGAGGATTACAGAAACG CCCTTGAGGTCCACATTTT
DFR (Aco006769.1.path1) AGCATCATCCCACCTCTTG TCGTCGTCATCGGTATCAG
3GT(Aco012126.1.path1) AGCACGTTCGGCTTAGGAC AGAGGCAGTTGCTCGGGTC
ABCA3(Aco006845.1.path1) AGGCGATGGGTTGGCTATGC AGAAGAAAGTTGCGGCGAGA
MYB5(Aco023263.1.path1) AGATGAGACCAAGAACCCAC CCCGCTATCAAAGACCAC