Skip to main content

Table 2 The primers used in this study

From: Genome-wide development of insertion-deletion (InDel) markers for Cannabis and its uses in genetic structure analysis of Chinese germplasm and sex-linked marker identification

Marker Position Forward Primer Reverse Primer Product (bp) MAF AlleleNo GeneDiversity PIC
I1–2 5,107,359 CCCTTGCACACTTATTTGACTAGT CCATTGCTGTTTATATTCGGGTGG 232 0.5739 4.0000 0.5462 0.4635
I1–4 35,070,118 CGATACAATCTAAGGGGAGTAGGC CTGAGAGTTAGCACCACCATTTTG 225 0.6261 4.0000 0.5072 0.4277
I1–6 55,100,664 TCAGTTAATAATCGCACGCACATC GATCCTGGTTCGTGAAATTGATGG 215 0.4522 4.0000 0.6865 0.6351
I2–10 45,232,264 CTAACTAACCATCTACTGCGACCA CTCTGGATCCATTTTCGTTTGAGG 217 0.4913 4.0000 0.6149 0.5407
I4–10 45,033,231 GTTCTAAGAGTGGATTCAACGAAGA TTACAATTTCACCCCTGCTTAGTG 198 0.5435 4.0000 0.6027 0.5376
I5–6 25,186,057 GACTTTGACACCATTCGAGTTCAG GTGTTTACCCCTTCTCACATAGGT 129 0.9348 4.0000 0.1243 0.1209
I5–9 40,002,310 TCATACTACTCTCCTGACCTCTCC AATTGTGATGTTTTCTTGGAGGGC 287 0.7870 4.0000 0.3609 0.3362
I6–2 5,003,421 GGATAAATCTCCGAAATGCACTCT GACAAGGTGATTTTGAAGAGTGGG 196 0.9217 3.0000 0.1470 0.1412
I6–6 25,003,694 TGGGCGAACTCAAGGTCAATATTA CCTCTAGGCCTTCTCAGCTTAATT 157 0.7739 4.0000 0.3774 0.3487
I6–7 30,129,906 GTCTACAACATCTCCTCCACTCTC ATTAAAATAGCCGCACGAAGAG 296 0.7000 4.0000 0.4429 0.3770
I6–8 35,088,175 TTTTGCTACTGGGAATTAGGCGAA CAGAGGAGTCCAAGGAAGAAGAAA 280 0.4478 3.0000 0.6379 0.5629
I7–4 15,048,834 AAAATCCCAACCACACCGACC CCACCACATCAAACCATTCAGATT 272 0.5652 3.0000 0.5255 0.4259
I8–2 5,036,397 AGCTCAATCTGCCCTTAGTTCTAC GTTCATGTTCTCTTCCTCTCCTGT 224 0.4957 3.0000 0.5605 0.4634
I8–4 15,041,707 TACTGCAGGATATGTGTAAAGCGT CACAATATGGGAGGAACAACAAGT 286 0.7652 5.0000 0.3950 0.3721
  1. MAF: Major Allele Frquency; PIC: Polymorphism Information Content