Skip to main content

Table 1 Primers for qRTPCR

From: Dysregulated long noncoding RNAs in the brainstem of the DBA/1 mouse model of SUDEP

Seqname Primers (5’3’) Amplicon size (bp)
uc007urg.1  F: TAGCAGTGGTGCCTGTGAC
R: GATGGACTCAGGAGGGTCAT
131
AK029922 F: GTCTTCTCCCGTTGGCTTCTATC
R: CTATCTGGGCTTATCTTGAGCAGAT
179
ENSMUST00000152600 F: TAAGCCCTAGATGGATGTGT
R: TACCAGTATGGGTCCCTAAA
132
ENSMUST00000172531 F: GCCGTGTTTTCACCCTTCTT
R: CACGCCACTGCCGATTTT
281
GAPDH F: CACTGAGCAAGAGAGGCCCTAT
R: GCAGCGAACTTTATTGATGGTATT
144
  1. Note: F forward, R reverse