Skip to main content

Table 2 Primer sequences used in the qPCR analysis

From: N7-methylguanosine modification of lncRNAs in a rat model of hypoxic pulmonary hypertension: a comprehensive analysis

Gene (GenBank) Primer sequence (5′-3′)
chr4:7450738–7,450,981 Forward GTGATGTGGAAGGGAGCACT
Reverse TGTCTGCCTCTCCGTCTTCT
chr13:95420341–95,420,800 Forward AGGACACCAAGGGAACACTG
Reverse CAGGTACCTCCCAAGCCATA