Skip to main content

Table 3 Universal primers for the 16S rRNA gene, and specific primers for the 16S rRNA and groESL genes of A. phagocytophilum, and primers for Y. pestis genes

From: Anaplasma phagocytophilum in Marmota himalayana

Target gene PCR stage Primer name Sequence Product length Reference
16S rRNA -a 27F AGA GTT TGA TCM TGG CTC AG varied [28]
1492R TAC GGY TAC CTT GTT ACG ACT T
16S rRNA Primary
PCR
Eh-out1 TTG AGA GTT TGA TCC TGG CTC AGA ACG 653 [31, 32]
Eh-out2 CAC CTC TAC ACT AGG AAT TCC GCT ATC
Nested
PCR
Eh-gs1 GTA ATA CT GTA TAA TCC CTG 282
Eh-gs2 GTA CCG TCA TTA TCT TCC CTA
HGA1 GTC GAA CGG ATT ATT CTT TAT AGC TTG 389
HGA2 TAT AGG TAC CGT CAT TAT CTT CCC TAC
groESL Primary
PCR
HS1 TGG GCT GGT A(A/C) TGA AAT 1431 [33]
HS6 CCI CCI GGI ACI A(C/T) ACC TTC
Nested
PCR
HS43 AT(A/T) GC(A/T) AA(G/A) GAA GCA TAG TC 480
HS45 ACT TCA CG(C/T) (C/T) TCA TAG AC
caf1 - a fra-1F GGAACCACTAGCACATCTGTT 249 [27]
fra-1R ACCTGCTGCAAGTTTACCGCC
pla - a pla-2F ACTACGACTGGATGAATGAAAATC 456
pla-2R GTGACATAATATCCAGCGTTAATT
  1. astands for conventional PCR