Skip to main content

Table 4 List of primers used for qPCR

From: Hepatopancreas transcriptome analyses provide new insights into the molecular regulatory mechanism of fast ovary maturation in Macrobrachium nipponense

Gene name Abbreviation name Forward and reverse primer (5′ -3′)
beta-glucuronidase-like bgl CACTTGGAAATCATTGAGCAGCA TTCAGCCTGGTATTCTTCTGTCC
beta-N-acetylglucosaminidase bNa AAGACTCTCCGGTGTTTCCTTAC
GTAGACAGGGAAAGAGTGTGTGT
Putative inorganic phosphate cotransporter ipc GGGGAATCAAACAATCACAGCTT
TCTGTTTGGGTTTTGGTTCGTTC
cytochrome P450 2 L1-like isoform X3 CYP-2L1l-3 CATTCTCTTCCTCTCCCTCGTTC
AGGGCATCCTTCATCAGTTTGTA
Threonine-rich protein trp AGGAGGAATGTTGAAAGCCGTAT
CGGAATCAGACGAAGAAAAGCAC
hydroxyacyl-coenzyme A dehydrogenase hcd CAGATGCAATACAACGATTGGGT
TGCATTCAACTGTGACTTTTCCC
Putative fatty acid elongation protein 3 fep3 CGAGAAACGACGATGGATGAAAG
CATGATTGCCCAGGACATAGAGA
V-type proton ATPase subunit d 1 V-pasd1 TTGAAGGAGCTGGAAACAATCCT
TGTCAATCTTTGCCCTGTGTTTC
40S ribosomal protein S25 40rib25 CCCAAGAAGGATACCAAGGGAAA
TCCGGTGATCTTGAGTCTTTCAG