Fig. 5From: Haplotype variations of sucrose phosphate synthase B gene among sugarcane accessions with different sucrose contentSPSB gene structure and the genomic region amplified by primers, spsB-GR1F and spsB-GT2R. The blue boxes represent exon sequence of SPSB gene, the black lines represent intron sequence, the blue triangle arrows represent primer sites for the amplification. spsB-GT1F: GTGTGCATGGTCTTGTTCGTG; spsB-GT2R: CGCAACCCGTTTCTCCGBack to article page