Skip to main content

Table 1 Sequences of primers and probes

From: Segmental duplication as one of the driving forces underlying the diversity of the human immunoglobulin heavy chain variable gene region

Tag Primer (5' to 3')  
  Location   Probe (5' to 3')
Name from to Forward Reverse Nested  
VHS429 428971 429130 ATATATACAAGATTAGTCCCACAATA ATACCAGCTCTACTATATATGAAAGTC TATGCAAGCATTAGATACCCATA AAACCATGCTGTCGCAGGGTC
VHS437 437246 437398 CACAAAATGCAGATTCACACTC AGCCTGTTCTAGTCATGGAATCTC GAAAAGTCCTCAACTGTGGTCA CCAGGAACGCCTGAGATTCCT
VHS444 444731 444867 CACCCCTTCACAACTGGGGAT TGGTAGCGCTGTGAGGTGATA TGGGGCAGGACACAAATCCAA TACCTGACCACCATGCGTATT
VHS449 449260 449427 GAACAGACAACCTGTGAATGGT ATTTCTGTTGAACACTTGTATGTCT AAATGTGCAGTCTATTCATCAAAT TATCTCGTTTTTGCTCACTCT
VHS454 454027 454155 TATTACCAGGAGACCAAAATCTC AAAGGAAGGTTGCTGGTAAGG ATACAGACAAACAGGCGAAGG GATTGCCTTTCGCCACATAGA
VHS458 458073 458214 CGAAATATAATTCTTGCTCTTCTG CAGGAGAATTATGAACATTGAGAG AGCACATCCTAGCATCCCTGT CATCGGCGTGTTTACATCTAC
VHS462 462778 462952 CGTTAGCTCTGTGAAAGCAGC TGATTTGTTCCCTTAGTTTCTGG CAGGTTTACTGTTAAGGAGGTCA TGGCTACTCAGCGTGCAAATG
VHS468 468656 468843 TTAGCATCTCCTATTTGAGTAGATTT TCTAGATATTCAGGAGGCTAATACA TGTTCCACAGCTTAAAGTACAGTT TGAGTCCGGAGCTCAAAATTA
VHS475 475730 475892 TGTAGTTTCCTTTATTGTGGTGC AATTCTTCCCAACAGAAAAGTG TTACTGGTAATACTATCATGGTAGTC AGGTAGTCTGCCATACACCTT
VHS479 479662 479810 GAAGCAAATTGATTAGTGTGCAG CAGCTGAATCGCTTTTGGTC TCTGCTTTGCCTGCTATTCAT TGAGAAACACACGGGTCTTAT
VHS485 485677 485819 GCTGTCTCCTAAGTAAGTCACAGG AGGGATTCAGTGCAAATTGAG ACACACCAACATCACCAACAT TCTATAGTTCGTTCGAGGAAGT
VHS493 493051 493239 GAGTGAGCCTTAAGTAATCAACAG CCCATCCCCTCCTTCTTTCTC TGACAACTTATTCTAGGTAGCAAGA CTGGGTCTTGTCCATCGATAC
VHS499 499270 499449 CTGAAGCTGCTTAATCACCGT TGTGTATTGATTTGACAAAACACTA TCTGCTCTGATGGAATCAGGG ATCGGTTGACTCTATGTTAGG
VHS504 504031 504171 TGTGGGTTGTTCTCACCATAATA ACAACTGGATGCACCTCCATA CCACCAGACACCCTCCAATAC CACTCCGACACATTATAAGAGA
VHS510 509963 510127 GTCGTGTATCTCACTTTCCACTA TTTAGTGGGATTTTAGAGAGTACAA GATGGAGTCCTGATCCCTGCC TTTCTGTGACCGTGTGTCACT
VHS514 514084 514235 GAGTGTGGACTGATCCATTGC ATACCATGTGCTGCTGACACC ATAGAATCCTTGCTTGGGGTCT CTAAACTGGCCGTAGGAAAGC
VHS518 518664 518809 CAAACCTGTCAGGGCACTTAG TGACAGTAAACCAGCCTCTCAT TCCAGGAAGACTCAAGACCAC CCCCAAGTGGTCGTGAGTCCC
  1. *Oligos are named using the corresponding tag names followed by a letter of F (forward primer), R (reverse primer), N (nested primer), or B (probe).
  2. **From the 5' end of the IGHV region.