Skip to content


You're viewing the new version of our site. Please leave us feedback.

Learn more

BMC Genomics

Open Access

A comparative study of nemertean complete mitochondrial genomes, including two new ones for Nectonemertes cf. mirabilis and Zygeupolia rubens, may elucidate the fundamental pattern for the phylum Nemertea

  • Hai-Xia Chen1, 2,
  • Shi-Chun Sun2,
  • Per Sundberg1,
  • Wei-Cheng Ren3 and
  • Jon L Norenburg4Email author
BMC Genomics201213:139

Received: 2 May 2011

Accepted: 17 April 2012

Published: 17 April 2012



The mitochondrial genome is important for studying genome evolution as well as reconstructing the phylogeny of organisms. Complete mitochondrial genome sequences have been reported for more than 2200 metazoans, mainly vertebrates and arthropods. To date, from a total of about 1275 described nemertean species, only three complete and two partial mitochondrial DNA sequences from nemerteans have been published. Here, we report the entire mitochondrial genomes for two more nemertean species: Nectonemertes cf. mirabilis and Zygeupolia rubens.


The sizes of the entire mitochondrial genomes are 15365 bp for N. cf. mirabilis and 15513 bp for Z. rubens. Each circular genome contains 37 genes and an AT-rich non-coding region, and overall nucleotide composition is AT-rich. In both species, there is significant strand asymmetry in the distribution of nucleotides, with the coding strand being richer in T than A and in G than C. The AT-rich non-coding regions of the two genomes have some repeat sequences and stem-loop structures, both of which may be associated with the initiation of replication or transcription. The 22 tRNAs show variable substitution patterns in nemerteans, with higher sequence conservation in genes located on the H strand. Gene arrangement of N. cf. mirabilis is identical to that of Paranemertes cf. peregrina, both of which are Hoplonemertea, while that of Z. rubens is the same as in Lineus viridis, both of which are Heteronemertea. Comparison of the gene arrangements and phylogenomic analysis based on concatenated nucleotide sequences of the 12 mitochondrial protein-coding genes revealed that species with closer relationships share more identical gene blocks.


The two new mitochondrial genomes share many features, including gene contents, with other known nemertean mitochondrial genomes. The tRNA families display a composite substitution pathway. Gene order comparison to the proposed ground pattern of Bilateria and some lophotrochozoans suggests that the nemertean ancestral mitochondrial gene order most closely resembles the heteronemertean type. Phylogenetic analysis proposes a sister-group relationship between Hetero- and Hoplonemertea, which supports one of two recent alternative hypotheses of nemertean phylogeny.


MtDNANemertea Nectonemertes mirabilis Zygeupolia rubens PhylogenyGene rearrangement


Knowledge of mitochondrial genomes is important for many scientific disciplines [1, 2] and the relative arrangement of mitochondrial genes has been effective for studying phylogenetic relationships [3, 4]. However, current knowledge of mtDNAs is uneven, and sequences available in GenBank are predominantly from vertebrate taxa. There are about 1275 described species [5] of nemerteans (ribbon worms, phylum Nemertea); these are mainly marine but terrestrial and freshwater species also are known. To date, complete mitochondrial genomes have been published for only three species in the phylum, Cephalothrix hongkongiensis (Palaeonemertea) [reported as Cephalothrix simula in [6]], Lineus viridis (Heteronemertea) [7], and Paranemertes cf. peregrina (Hoplonemertea)[8]. Nearly complete sequences exist for the palaeonemerteans Cephalothrix sp. [8] and Cephalothrix rufifrons[9]. Thus, current genomic knowledge of nemerteans is scant and taxon diversity is poorly sampled. In this study, we sequenced the complete mitochondrial genomes of two nemertean species, Nectonemertes cf. mirabilis (Hoplonemertea: Polystilifera) and Zygeupolia rubens (Heteronemertea). Mitochondrial gene arrangements, structures, and compositions, as well as translation and initiation codons and codon usage patterns, were compared with complete mtDNA sequences of other nemerteans. In addition, we compare gene order among Lophotrochozoa and we use the nucleotide sequences to analyze phylogenetic relationship among the included nemerteans.

Results and discussion

Genome organization and structure

Genome composition and gene arrangement of Nectonemertes cf. mirabilis and Zygeupolia rubens are summarized in Figure 1 and Table 1. The mitochondrial genomes of N. cf. mirabilis and Z. rubens are circular DNA molecules of 15365 bp and 15513 bp, respectively. Lengths of the two nemertean mitochondrial genomes are within the range of previously sequenced nemertean mtDNAs - 14558 bp in Paranemertes cf. peregrina to 16296 bp in Cephalothrix hongkongiensis[6]. Both of the newly sequenced mitochondrial genomes contain 37 genes, including 13 protein-coding genes, two ribosomal RNAs, and 22 transfer RNAs. All genes except trnP and trnT are encoded on the same strand (Figure 1).
Figure 1

Circular representation of the mtDNA of Nectonemertes cf. mirabilis and Zygeupolia rubens. Genes on the outer (H) strand are transcribed clockwise; those on the inner (L) strand are transcribed counter-clockwise. Transfer RNA genes are designated by the one-letter amino acid code for the corresponding amino acids; trnL1, trnL2, trnS1, and trnS2 differentiated on the basis of their codons CUN, UUR, UCN, and AGN, respectively. AT-rich non-coding region is represented in grey. The other small non-coding regions are not marked.

Table 1

Location of genes in the mitochondrial genomes of Nectonemertes cf. mirabilis and Zygeupolia rubens

Nectonemertes cf. mirabilis

Zygeupolia rubens


From 5'to 3'

Size (bp)



From 5'to 3'

Size (bp)










trnP b




trnP b




















trnS1 (UCN)








trnT b




trnT b




















































































































































trnS2 (AGN)
















































































































aNegative numbers indicate that genes were overlapping

bGenes coding in L strand

For both species, protein-coding genes nad4L and nad4 share an overlap, by seven nucleotides, and nad6 overlaps cob by eight nucleotides in Z. rubens (Figure 1, Table 1). Such overlaps are common to all known mtDNA genomes of nemerteans [6, 8], and are found in many metazoan mtDNAs [10].

Protein-coding genes

Thirteen protein-coding genes (cox1-cox3, nad1-nad6, nad4L, cob, atp6, and atp8) were identified. Mitochondrial genomes often use a variety of nonstandard initiation codons [11]. Except for nad4 (GTG), nad5 (GTG), atp8 (GTG) and atp6 (GTT) in N. cf. mirabilis, and nad1 (GTG) and nad2 (GTG) in Z. rubens, the protein-coding genes of both species begin with ATG. The majority of genes in both species contain the full termination codon TAA or TAG, but some end with T (atp8 in N. cf. mirabilis, and nad5, cox2 and nad1 in Z. rubens). Such abbreviated stop codons are common among animal mitochondrial genes. In Z. rubens, the incomplete stop codons are immediately followed by the downstream tRNA gene (Figure 1, Table 1), whose secondary structure has been suggested to act as a signal for the cleavage of the polycistronic primary transcript [12, 13]. However, there also are direct junctions pairing ten protein-coding genes in N. cf. mirabilis (nad6/cob, nad4L/nad4, nad3/cox1, nad2/cox2, and atp8/atp6) and eight in Z. rubens (nad6/cob, nad4L/nad4, nad2/cox1 and atp8/atp6) (Figure 1, Table 1). Here, cleavage signals other than secondary structure of a tRNA gene may initiate processing of the polycistronic primary transcript [14]. For two protein-coding genes (nad6 and nad2) in both nemertean species and nad3 in N. cf. mirabilis, stem-loop structures were inferred to be at the 3' end and abutting the 5' end of the neighboring protein-coding gene, and may signal cleavage of the immature mRNA [15, 16].

Transfer RNA and ribosomal RNA genes

Both of the mitochondrial genomes encoded 22 tRNA genes found in other nemertean mtDNAs, which is typical of animal mitochondrial genomes [10]. They varied from 60 (trnH) to 68 (trnS2) nucleotides in N. cf. mirabili s and 61 (trnK) to 72 (trnS2) nucleotides in Z. rubens (Table 2); most were folded into a typical cloverleaf secondary structure (Figures 2, 3). The postulated tRNA cloverleaf structures generally contained 7 bp in the aminoacyl stem, 2 to 5 bp in the TψC stem, 5 bp in the anticodon stem, and 0 to 4 bp in the dihydrouridine (DHU) stem. Some tRNAs showed DHU-loop replacement (e.g., trnS1 of N. cf. mirabili s), as also found in L. viridis and P. cf. peregrina. In general, the lack of a DHU arm in two serine tRNAs is a common condition in metazoan mtDNAs [17]. The presence of such aberrant tRNA genes in mitochondrial genomes could be due to modification of tRNA secondary structure by replication slippage [18], or selection for mitochondrial genome minimization [19].
Table 2

Base composition of the mtDNA in six nemerteans


Total nt





A + T

AT skew

GC skew


Cephalothrix hongkongiensis










Cephalothrix sp.










Paranemertes cf. peregrina










Nectonemertes cf. mirabilis









Present study

Lineus viridis










Zygeupolia rubens









Present study

Figure 2

Secondary structure of tRNA families ( trnA - trnL1 ) in nemertean mtDNAs. The nucleotide substitution pattern for each tRNA family was modeled using as reference the structure determined for Nectonemertes cf. mirabilis.

Figure 3

Secondary structure of tRNA families ( trnL2 - trnV ) in nemertean mtDNAs. The nucleotide substitution pattern for each tRNA family was modeled using as reference the structure determined for Nectonemertes cf. mirabilis.

The mtDNAs of nemerteans investigated to date all have 20 tRNAs on the L strand and 2 tRNAs on the H strand ([69]). Secondary structures of nemertean tRNAs are presented and compared in Figures 2 and 3 (pattern follows [20]). Table 3 presents the tRNA lengths and the percent of identical nucleotides (%INUC) for the six nemerteans.
Table 3

Summary of multiple alignments of tRNA genes in nemertean mtDNAs


amino acid




















































Leucine (CUN)





Leucine (UUR)














trnP a
















Serine (UCN)





Serine (AGN)




trnT a




















ALN, alignment name; %INUC, percent of identical nucleotides

agenes on the L strand

Nucleotide conservation was strongest on the H strand, with trnC, trnG and trnM, having the highest levels of nucleotide conservation (%INUC > 50), followed by TrnE, trnL2, trnQ, trnS2, trnV and trnY at 40 ≤ %INUC ≤ 50 (Figure 2). The ten remaining tRNAs had %INUC values between 30 and 40; eight - trnD, trnF, trnH, trnI, trnK, trnL1, trnS1 and trnW - are located on the H strand, while two - trnP and trnT - are on the L strand. H-strand genes trnA, trnN and trnR had %INUC values ≤30.

Conservation was positively H strand-biased, but no other pattern could be identified with respect to location of tRNAs along the genome. Two of the three most conserved tRNAs, trnC and trnM, are adjoining, while the third, trnG, adjoins the moderately conserved trnE and is relatively close to the three least conserved genes, trnA, trnN and trnR (Figure 1, Table 1). As observed by others (e.g., [20]), there was no self-evident link between abundance of codon families and the level of tRNA conservation, with the most abundant codon families (Leu2, Ile and Phe) not having the highest %INUCs (see below).

A few mismatched nucleotide pairs (e.g., G-A, A-A, T-C, T-T) were found in the acceptor and/or the discriminator arms, without regard to the overall level of conservation of the tRNAs. As recently pointed out by Negrisolo et al. [20] for arthropods, metazoan mtDNAs commonly have such mismatches. It has been suggested that these may be corrected via RNA-editing mechanisms (e.g., [17]) or they may represent unusual pairings [21].

Among the most conserved tRNAs in nemerteans, as in insects (e.g., [20]), nucleotide substitutions are mostly confined to TΨC and DHU loops and extra arms (Figures 2, 3), with 2-7 fully compensatory base changes (cbc; e.g., G-C vs. A-T) or hemi-cbcs (e.g., T-A vs. T-G) on acceptor and anticodon stems (see [20, 22]). As in insects [20], the number of cbcs and hemi-cbcs increased in stems as overall variation increased, especially in the TΨC stem.

As found in insects, cbcs and hemi-cbcs characterized either single species or taxa at a higher taxonomic rank. An example of the first type is the A-T pair found in the trnC acceptor arm of P. cf. peregrina, which was mirrored by G-C in all other nemerteans (Figure 2). Few substitutions were present among C. hongkongiensis and Cephalothrix sp. (Figures 2, 3). An example of a full cbc characterizing a unique family is the A-T pair found in the acceptor stem of trnL1s of family Lineidae (L. viridis and Z. rubens), while other taxa exhibited the G-C pair (Figure 2). Similarly, a full cbc in the anticodon stem of trnG of two hoplonemerteans characterizes another high-taxonomic rank (Figure 2). Figures 2 and 3 depict several more examples. This points to the potential phylogenetic value of tRNA sequences, as demonstrated for other animal groups (e.g., [20, 23]), especially when secondary structures are taken into account [20]. While encouraging, clearly we need substantially more nemertean mitochondrial genomes to test this assertion for nemerteans.

The anticodon usage of N. cf. mirabili s and Z. rubens was congruent with the corresponding tRNA genes of other nemerteans, with one exception. The anticodon of the trnS2 (AGN) gene in N. cf. mirabili s, P. cf. peregrina and three Cephalothrix species is GCT, but it is TCT in L. viridis and Z. rubens. Cameron et al. [24] found that anticodon changes in trnS2 (AGN) (GCT→TCT) must have occurred in the common ancestor of the insect clade Ischnocera, which was consistent with its phylogeny of lice. Similarly, this may constitute a kind of "rare genomic change" [25] in nemerteans and be a synapomorphy of Lineidae.

As in all other metazoan mtDNAs sequenced to date, N. cf. mirabili s and Z. rubens mtDNAs contain genes for both small and large ribosomal subunit RNAs (rrnS and rrnL). Both genes are encoded by the same strand and are separated by trnV, as in many other metazoans. For N. cf. mirabili s and Z. rubens, respectively, the lengths of rrnL/rrnS are 1178/805 bp and 1248/836 bp, and the A + T contents are 75.5/72.4% and 70.9/70.5%.

Base composition and codon usage

The mtDNA of many invertebrates is characterized by a composition bias showing high values of A% and T% over G% and C%. The overall A + T content of N. cf. mirabili s and Z. rubens (70.3% and 66.0%, respectively) is consistent with those observed in other nemertean mitochondrial genomes. Though sample size for nemerteans is small, the A + T values appear to be linked in less (e.g., genus - e.g., Cephalothrix sp./C. hongkongiensis), as well as in more inclusive taxa (e.g., order - e.g., P. cf. peregrina/N. cf. mirabili s; L. viridis/Z. rubens) (Table 2). This might indicate a phylogenetic signal in nemerteans.

Another feature of metazoan mtDNAs is asymmetry in nucleotide composition between the two strands, with one being rich in A and C, and the other being rich in T and G [26]. This asymmetry also is evident in the two nemertean mtDNA genomes here, with the genes encoded on the coding strand showing a strong bias toward T over A and toward G over C, as seen in the four other nemerteans, which have similar skewnesses (Table 2; Figure 4). This situation is common for mitochondrial genomes [26] and may be due to the presence of asymmetric patterns of mutational changes between strands [27, 28], and has been related with nucleotide deamination of DNA while transiently single-stranded during replication (this is not without controversy [29]) and/or transcription [30]. The relative importance of the two contributing processes (i.e., transcription vs. replication) remains to be assessed.
Figure 4

Graphical representation of the percentage of A (black) and T (gray) across the whole mtDNA segment of six nemertean species (Accelrys). Y-axis values represent nucleotide %, calculated with a 100-bp sliding window using the program MacVector® 7.2.3; x-axis values represent the nucleotide positions corresponding to the linearized genome.

We follow the pattern of [2] for displaying codon family abundance and relative synonymous codon usage (RSCU) for available nemertean protein-coding genes (Figures 5 and 6). To avoid bias due to incomplete stop codons, all stop codons are excluded from the analysis. The six nemertean mtDNAs use similar total numbers of non-stop codons (CDs), ranging from 3662 in P. cf. peregrina to 3707 in L. viridis. The codon families reveal a consistent pattern among the six nemertean species: the families with at least 50 CDs per thousand CDs (Leu1, Ile, Phe, Gly, Val) encompass an average 48.78% ± 1.33% of all CDs (Figure 5), with CDs rich in A + T favored over synonymous CDs of lower A + T content (Figure 6). For instance, the TTA codon accounts for a large majority of CDs in the Leu1 family. Whereas representation of the Leu1 (average = 77.3 ± 7.3%) and Leu2 (average = 22.7 ± 7.3%) codon families in nemertean protein-coding genes differs greatly, that of Ser1 (average = 60.8 ± 7.3%) and Ser2 (average = 39.2 ± 7.3%) is less extreme.
Figure 5

Codon distribution in nemertean mtDNAs. CDspT, number of codons per thousands codons. Numbers to the right refer to the total number of codons.

Figure 6

Relative Synonymous Codon Usage (RSCU) in nemertean mtDNAs. Codon families are provided on the x-axis, codons not present in the genome are orange colored.

The invertebrate mitochondrial genome codes for 62 amino-acid codons [10]. As pointed out for Lepidoptera [2], the total number of codons used seems to be linked to the A + T content, which is the case among the six nemertean genomes analyzed. Thus, Cephalothrix sp. mtDNA has the highest (A + T)% content (see Table 2) and uses only 58 codons, never using the four codons rich in G + C (TCG, CGC, ACG, CGC) (Figure 6). Lineus viridis mtDNA uses all 62 codons and has the lowest A + T% among known nemertean genomes.

The abundance of the four amino acid residues - Leu, Ile, Phe and Ser - is typical for invertebrate membrane proteins [2, 31], and they account here for more than 46.70% (average A + T = 50.14 ± 2.70%) of residues comprising the 13 mitochondrial proteins. The Leu and Ile amino acids share hydrophobic lateral chains.

Two- and four-fold degenerate codon usage was similarly biased, with A/T favored over G/C in the third position (Figure 6) and in agreement with the AT-bias of protein-coding genes. Since the nemertean mitochondrial genome is AT-rich (Table 2), it can be expected that codons ending in A or T will predominate. From the overall RSCU values, it could be assumed that compositional constraints are the factor in shaping variation in codon usage among the genes in these mitochondrial genomes.

Non-coding regions

Metazoan mtDNAs usually have lengthy non-coding regions varying in size from ~100 bp to > 20 kbp [32, 33]. The mtDNAs of N. cf. mirabili s and Z. rubens contain a large number of unassigned nucleotides. There are 23 non-coding regions, with up to 855 nts, found throughout the N. cf. mirabili s mitochondrial genome. The AT-rich region located between the nad3 and trnS2 genes accounts for 838 nts and its AT content is 81.5%, which is higher than the remainder of the genome. Zygeupolia rubens has up to 879 non-coding nts distributed in 15 regions. The AT-rich region located between trnW and trnS2 genes is 702 nts and has an AT content of 74.9%, which also is higher than the remainder of the genome.

In most metazoan mtDNAs, the largest non-coding region is thought to contain signals for replication and transcription, and is thus referred to as the control region [11]. The non-coding region has an increased AT composition, a characteristic typically used to identify origins of replication [10]. As in mtDNA genomes of other nemerteans, the AT-rich regions of N. cf. mirabili s and Z. rubens mtDNAs have the potential to form secondary structures such as stems and loops (Figure 7), which are thought to play an important role in the early stages of the replication and transcription process [34, 35]. Additionally, the AT-rich region in mtDNA of N. cf. mirabili s contains the tandemly repeated sequences (AAAAATATAAGATTTTTCAAATTCCAAAAATATAAAAT)3, (TTTTG)10, (TTTTTC)7, and several (A)n and (T)n homopolymer tracts. In mtDNAs of Z. rubens, we found the tandemly repeated sequences (GGGGGGGGGGGTAGTGTGGTTATGTTTTACTACACTCTTAGTAAAATATAAA)2, (TTTTTTG)10, and (TTTTTTTTA)6. Similar tandem repeat units within the largest non-coding regions also were found in the nemerteans Cephalothrix sp. [8], and C. hongkongiensis[6]. Tandem repeats are common within the control region of animal mtDNAs [34] and might be associated with regulatory mechanisms and recombination hot spots, and they might be the result of replication slippage events [36]. The high AT content and the predicted secondary structures of the AT-rich non-coding region of the N. cf. mirabili s and Z. rubens mtDNAs suggest that this region most likely contains the control region, though the control region in invertebrates, unlike that of vertebrates, is not well characterized and lacks discrete and conserved sequence blocks used in identification [37]. The nemertean mtDNA sequences examined here had multiple non-coding regions throughout their genomes. However, the location of the largest non-coding region is not conserved, and there is no obvious conservation of size (e.g., [6, 8]), nucleotide identities or potential secondary structures for the nemertean non-coding regions.
Figure 7

Secondary structures predicted for the non-coding regions in the mitochondrial genome of two nemerteans. (A) Nectonemertes cf. mirabilis, AT-rich non-coding region between genes trnW and trnS2; (B, C) Zygeupolia rubens, AT-rich non-coding region between genes nad3 and trnS2.

Gene order comparison

Gene arrangements of the animal mitochondrial genome usually remain stable over long periods of evolutionary time, especially for protein-coding genes [10]. With some exceptions, mitochondrial gene order is relatively stable within major groups, and more variable between them [14]. This is the case for available nemertean mtDNA genomes, with mitochondrial genes transcribed from the same strand except for trnP and trnT. Among the three species of Cephalothrix (C. hongkongiensis, C. sp. and C. rufifrons), the gene order is identical for two but that of C. rufifrons differs from them. The two hoplonemertean species (P. cf. peregrina, N. cf. mirabili s) are identical to each other in gene order, as is the case for the two heteronemerteans (Z. rubens, L. viridis). The hoplo- and the heteronemertean species differ only by a translocation of the gene block S2/nad2 but they differ significantly from the three Cephalothrix species in the positions of atp8, nad6, nad2 and several tRNAs. The highest number of common intervals (1124) is between hoplo- and heteronemerteans, as indicated by results from CREx [38].

We use two different gene sets, "all genes" and "non-tRNA genes" to compare the mt gene orders of nemerteans to the proposed ground pattern of Bilateria [39] and to mitochondrial gene orders of various lophotrochozoans: Terebratulina retusa (Brachiopoda) [40], Katharina tunicata (Mollusca)[14], Phoronis psammophila (Phoronida) [41], Perionyx excavatus (Annelida) [42], Urechis caupo (Annelida) [43] and Sipunculus nudus (Annelida)[44]. For the "all genes" set, all nemerteans share the adjacency nad4L/nad4 with the ground pattern of Bilateria and with the selected species (Figure 8). Nemerteans share the adjacencies rrnS/V/rrnL with Bilateria and the other species except U. caupo. The adjacency H/nad5 is shared by nemerteans and the selected species. Based on both gene sets, the hetero- and hoplonemerteans share the adjacency nad6/cob with K. tunicata[14], P. psammophila[41], P. excavatus[42], U. caupo[43], and S. nudus[44] and they share the adjacency atp8/atp6 with T. retusa, K. tunicata and the putative ground pattern of Bilateria (Figure 8; Additional file 1: Figure S1). These adjacencies may be a common plesiomorphic feature of Lophotrochozoa, such as Mollusca, Brachiopoda, and also Arthropoda mitochondrial genomes (e.g., [10]; [44]). However, neither of the latter two adjacencies is present in two Cephalothrix species, nor in the bryozoan Flustrellidra hispida[45].
Figure 8

Mitochondrial gene order (all 37 genes) of Nemertea and selected lophotrochozoan species and the putative bilaterian ground pattern (according to [39]). Gene segments are not drawn to scale. All genes are transcribed from left to right except those in gray, which are transcribed from right to left. Unsequenced regions are in black. The adjacencies nad6/cob and atp8/atp6 are underlined. Previous gene orders from the following references: Cephalothrix [6, 8], Lineus [7], Paranemertes [8], Terebratulina [40], Katharina [14], Phoronis [41], Perionyx [42], Urechis [43], Sipunculus [44].

In addition to visual comparison of genome maps, we analyzed gene order data with CREx [38], determining the number of common intervals. As shown in Table 4, the nemerteans share the highest number of common intervals (154, 184, 212) with K. tunicata and with P. psammophila (but this is a partial mitochondrial genome), while the lowest number was obtained in comparison with U. caupo (28, 18, 18). Although not significant, nemerteans and T. retusa, K. tunicata, and P. excavatus yield the highest numbers (18-20) in comparison with the putative bilaterian ground pattern.
Table 4

Pairwise common interval distance matrix of mitochondrial gene orders of nemerteans, the putative bilaterian ground pattern and six other lophotrochozoans *

Common interval











Bilaterian ground pattern (B)











Palaeonemertean (P)











Heteronemertean (H)











Hoplonemertean (H)











Terebratulina retusa (Tr)











Katharina tunicata (Kt)











Urechis caupo (Uc)











Sipunculus nudus (Sn)











Perionyx excavatus (Pe)a











Phoronis psammophila (Pp)b











*bold numbers represent pairwise common interval distances between mitochondrial gene orders (37 genes in total), while italic numbers represent pairwise common interval distances between mt gene orders without tRNAs (15 genes in total)

alacks trnR

blacks several tRNAs

Figure 8 shows tRNA genes change relative position much faster than the protein-coding and rRNA genes, as reported from previous studies (e.g., [46, 47]).

Excluding tRNAs, the gene order of heteronemerteans is identical to that of T. retusa[40] and some gastropods, e.g., Conus textile[48], Ilyanassa obsoleta[49], Thais clavigera[37] and Lophiotoma cerithiformis[50]. Other molluscs, like the polyplacophoran K. tunicata[14], the gastropod Haliotis rubra[51] and the cephalopod Octopus vulgaris[52] show a similar gene order, but are distinguished by a large inversion of about half the mt genome (Additional file 1: Figure S1). Without tRNAs, heteronemerteans and T. retusa, which has the same gene order, share the greatest number of possible common intervals (204) (Table 4), and both share the greatest number (52) with the putative bilaterian ground pattern.

We also determined breakpoints and reversal distances between these taxa with the two gene sets (Additional files 2, 3: Tables S1, S2). For "all genes", hetero- and hoplonemerteans share the same breakpoint distance (31) and the same reversal distance (28) (whereas palaeonemerteans are 32 and 31, respectively) with respect to the putative bilaterian ground pattern. Heteronemerteans have the lowest values among the nemerteans when tRNAs are excluded from the analysis. These comparisons with the putative bilaterian ground pattern and with other lophotrochozoans gene orders (especially when excluding tRNAs), suggest that the heteronemertean gene order is likely to be closest to the ancestral mitochondrial gene order of Nemertea. This is in agreement with a previous study [7].

Phylogenetic analysis

We performed a phylogenetic analysis based on nucleotide sequences of protein-coding genes to better understand relationships within the Nemertea. The phylogenetic tree in Figure 9, reconstructed by maximum likelihood and Bayesian analyses, indicates that similar gene arrangements reflect close phylogenetic affinity. This supports previous hypotheses that Hoplonemertea and Heteronemertea are sister taxa (e.g., [5355]). However, a phylogenetic analysis based on amino acid sequences (data not shown) suggests Hoplonemertea as sister group to Palaeonemertea. This contradicts many but not all previous analyses (e.g., [55]). We consider it unsupported by our data, given the low Bayesian posterior probability (0.61) for this clade. This suggests, however, that amino acid sequence data deserve continued attention in future analyses with new, additional data.
Figure 9

Best tree from the Maximum Likelihood analysis with 5921 nt (first and second codon positions) of protein-coding genes. Node support is indicated above (Bayesian posterior probabilities) and below (maximum likelihood bootstrap values) each branch. A Bayesian analysis resulted in the same species topology.


To date, complete or nearly complete mtDNA sequences have been determined for seven nemerteans, a very small sampling compared to those available for vertebrates or arthropods. The two new mtDNA genomes, for Nectonemertes cf. mirabilis and Zygeupolia rubens, share substantial similarity with those of other nemertean mitochondrial genomes, and gene content and A + T richness is similar to those common for animal mtDNAs.

There is strong skew in the distribution of nucleotides between the two strands.

The evolution of nemertean tRNAs seems to have been variable both in terms of sequence conservation and nucleotide substitution processes. The presence of full and hemi-cbcs characterizing taxa at different taxonomic levels may indicate the potential phylogenetic value of tRNA sequences.

Nemertean mtDNAs are punctuated by non-coding portions highly variable in size. Among them, the AT-rich non-coding region, which appears to be a fast-evolving genomic region characterized by short to medium-size repeated motifs/AT-rich patterns, may be associated with the initiation of replication or transcription.

Phylogenetic analysis supports the close phylogenetic affinities in nemerteans one might infer from similarities in gene arrangements, with Hetero- and Hoplonemerteans as sister-clades. Gene order analysis suggests that the heteronemertean pattern most closely resembles the likely ancestral condition among nemerteans, which is counterintuitive in light of the phylogenetic analysis. Confidence that we understand evolution of the nemertean mitochondrial genome is likely to require investigating many more nemertean mtDNAs, especially a full representation of palaeonemertean diversity.


DNA extraction, PCR and sequencing

Specimens were collected off Point Conception, California (Nectonemertes cf. mirabilis) and at Fort Pierce, Florida (Zygeupolia rubens), USA. We use the "cf." qualifier to confer reasonable caution that the Pacific worm traditionally designated N. mirabilis (see [56]) is conspecific with its presumed cognate originally described from the North Atlantic Ocean. Samples were frozen in liquid nitrogen and preserved in RNAlater. Total DNA was extracted from a single individual specimen using the DNeasy Tissue Kit following the manufacturer's protocol (Qiagen, Valencia, CA, USA). PCR primers used for amplification are listed in Table 5. Preliminary nemertean-specific primers (N12SF, N16SR, NCOX2R) were designed based on sequence alignment of four mitochondrial genome sequences (Cephalothrix hongkongiensis, Cephalothrix. sp., Lineus viridis, and Paranemertes cf. peregrina) retrieved from Genbank. For both species, the partial regions rrnS-rrnL and rrnL-cob were amplified first. For N. cf. mirabilis, partial fragments of cox1 and cox3 genes were amplified using universal PCR primers LCO-2198/HCO-1490, cox3F/cox3R ([59]; [9]). These sequences were used to design specific primers to amplify the remaining mitochondrial genome fragments (cob-cox3, cox3-cox1 and cox1-rrnS). For Z. rubens, the fragment of cox1-cox2 was amplified using the universal primer LCO-2198 [59] combined with the specific primer NCOX2R. Based on sequences obtained, specific primers were designed to amplify the regions cox2-rrnS, cob-cox3 and cox3-cox1. Conventional PCR and long PCR, cloning, and sequencing were performed as described in Chen et al. [6, 8].
Table 5

PCR primers used to amplify the mitochondrial genomes of Nectonemertes cf. mirabilis

Primer name

Sequence (5' → 3')








Present study



Present study









Nectonemertes cf. mirabilis




















Nm cobF


Present study



Present study





Present study



Present study





Present study



Present study

Zygeupolia rubens




Zrcob F


Present study



Present study








Present study








Present study





Present study



Present study

Sequence assemblage and annotation

All sequences were checked and assembled by visual inspection using the program SeqMan (DNA star, Madison, WI, USA). Protein-coding genes and ribosomal RNA genes were identified by their similarity to previously reported mitochondrial genomes of Cephalothrix hongkongiensis (GenBank #NC_012821), C. rufifrons (EF140788), Cephalothrix sp. (NC_014869), Lineus viridis (NC_012889), and Paranemertes cf. peregrina (NC_014865). Most tRNAs were identified by using invertebrate mitochondrial codon predictors with tRNAscan-SE 1.21 [60]. The remaining tRNA genes were found by inspecting sequences for tRNA-like secondary structures and anticodons. Multiple alignments of tRNA genes were produced, and the percent of identical nucleotides (%INUC) was calculated for six nemertean tRNA sequences. Secondary structures within the non-coding fragments were visualized by using RnaViz 2.0 [61], and the mitochondrial genome was visualized using CGView [62].

Genomics analysis

Nucleotide composition and Relative Synonymous Codon Usage (RSCU) values were analyzed with MEGA 4.0 [63]. AT- and GC-skew were determined by using the formulation of [26].

Gene order comparisons

Gene orders were compared between all available nemerteans (see above), the putative bilaterian ground pattern [39], Terebratulina retusa[40], Katharina tunicata[14], Phoronis psammophila[41], Perionyx excavatus[42], Urechis caupo[43] and Sipunculus nudus[44].

The gene orders were compared with two different gene sets: "all genes" included all 37 mitochondrial genes, whereas "non-tRNA genes" included only the two ribosomal genes and the 13 protein-coding genes.

The differences between gene orders were analysed using common intervals [38], breakpoints [64] and reversal distances [65] implemented in the CREx tool [38].

Phylogenetic analysis

The currently available near-complete and complete mitochondrial nemertean genome data (Cephalothrix sp., C. hongkongiensis, L. viridis, and P. cf. peregrina, but not the partial genome sequence of C. rufifrons) were combined with sequences from this study for phylogenomic analyses. The nucleic acids for all 12 protein-coding genes (except atp8, which is shortest and least conserved between the taxa) were aligned using Clustal X [66] with the default settings. Ambiguously aligned portions of both alignments were excluded using Gblocks version 0.91b [67] with default block parameters. We also excluded third codon positions because of the fast substitution rate. The total number of nucleotides used for the phylogenetic analysis was 5921.

Based on previous studies of metazoan relationships (e.g., [6873]), the following six species were selected as outgroups: a mollusc (Katharina tunicata), a brachiopod (Terebratalia retusa), a phoronid (Phoronis psammophila), and three annelids (Perionyx excavatus, Sipunculus nudus and Urechis caupo).

Phylogenetic trees were estimated under maximum likelihood (ML) and Bayesian inference (BI). ML analysis on the combined nucleotide dataset alignments was performed in RAxML 7.2.7 [74, 75] available on the CIPRES web portal [76] with the GTRGAMMA substitution model. Support was estimated by performing 1000 bootstrap replicates. BI analysis was performed with MrBayes version 3.0b4 [77, 78], using GTR + I + G model, a best-fit model selected by MrModeltest v2.2 [79] following the Akaike information criterion (AIC). The Monte Carlo Markov chain (MCMC) length was 1,000,000 generations and sampled every 100 generations. The first 2500 trees from each run were discarded as a burn-in.

Amino acid sequences were aligned with both Clustal X [66] and MAFFT using the G-INS-i strategy [80]. BI analyses were performed with MrBayes version 3.0b4 [77, 78] with the mtRev + I + G model, selected by Protest 10.2 [81] as optimal. We also implemented the CAT + GTR model in PhyloBayes 3 [82]. The ML analysis was carried out with RAxML 7.2.7 [74, 75] with CAT model.

The mitochondrial genome sequences of N. cf. mirabilis and Z. rubens are deposited in GenBank under the accession numbers HQ997772 and HQ997773.


atp6 and atp8

ATP synthase subunits 6 and 8


cytochrome b

cox1-3 subunits I-III of cytochrome c


nad1-6 and nad4L

NADH dehydrogenase subunits 1-6 and 4 L

rrnL and rrnS

the large and small subunits of ribosomal RNA


genes encoding for transfer RNA molecules with corresponding amino acids denoted by the one-letter code and codon indicated in parentheses (xxx) when necessary


dihydrouridine loop


mitochondrial DNA


non-coding region


polymerase chain reaction




base pair



nucleotide symbol combination: 

R = A/G











This work was supported by the National Natural Science Foundation of China (to SCS, grant no. 30970333,), the Swedish Research Council (to PS), Smithsonian Institution Scholarly Studies, Research Opportunities, and Marine Science Network awards (to JLN) and represents contribution 878 of the Smithsonian Marine Station at Fort Pierce. JLN is grateful to James Childress (UCSB) and his support from the US National Science Foundation for the opportunity to collect living Nectonemertes cf. mirabilis.

Authors’ Affiliations

Department of Biological and Environmental Sciences, University of Gothenburg
Institute of Evolution & Marine Biodiversity, Ocean University of China
Department of Rheumatology and Inflammation Research, Sahlgrenska Academy, University of Gothenburg
Department of Invertebrate Zoology, National Museum of Natural History, Smithsonian Institution


  1. Hu M, Chilton NB, Gasser RB: The mitochondrial genomics of parasitic nematodes of socio-economic importance: recent progress, and implications for population genetics and systematics. Adv Parasitol. 2004, 56: 133-212.View ArticlePubMedGoogle Scholar
  2. Salvato P, Simonato M, Battisti A, Negrisolo E: The complete mitochondrial genome of the bag-shelter moth Ochrogaster lunifer (Lepidoptera, Notodontidae). BMC Genomics. 2008, 9: 331-10.1186/1471-2164-9-331.PubMed CentralView ArticlePubMedGoogle Scholar
  3. Boore JL, Brown WM: Big trees from little genomes: mitochondrial gene order as a phylogenetic tool. Curr Opin Genet Dev. 1998, 8 (6): 668-674. 10.1016/S0959-437X(98)80035-X.View ArticlePubMedGoogle Scholar
  4. Lavrov DV, Brown WM, Boore JL: Phylogenetic position of the Pentastomida and (pan)crustacean relationships. Proc Biol Sci. 2004, 271 (1538): 537-544. 10.1098/rspb.2003.2631.PubMed CentralView ArticlePubMedGoogle Scholar
  5. Kajihara H, Chernyshev AV, Sun SC, Sundberg P, Crandall FB: Checklist of nemertean genera and species published between 1995 and 2007. Spec Diver. 2008, 13: 245-274.Google Scholar
  6. Chen HX, Sundberg P, Norenburg JL, Sun SC: The complete mitochondrial genome of Cephalothrix simula (Iwata) (Nemertea: Palaeonemertea). Gene. 2009, 442 (1-2): 8-17. 10.1016/j.gene.2009.04.015.View ArticlePubMedGoogle Scholar
  7. Podsiadlowski L, Braband A, Struck TH, von Döhren J, Bartolomaeus T: Phylogeny and mitochondrial gene order variation in Lophotrochozoa in the light of new mitogenomic data from Nemertea. BMC Genomics. 2009, 10: 364-10.1186/1471-2164-10-364.PubMed CentralView ArticlePubMedGoogle Scholar
  8. Chen HX, Sundberg P, Wu HY, Sun SC: The mitochondrial genomes of two nemerteans, Cephalothrix sp. (Nemertea: Palaeonemertea) and Paranemertes cf. peregrina (Nemertea: Hoplonemertea). Mol Biol Rep. 2011, 38 (7): 4509-4525. 10.1007/s11033-010-0582-4.View ArticlePubMedGoogle Scholar
  9. Turbeville JM, Smith DM: The partial mitochondrial genome of the Cephalothrix rufifrons (Nemertea, Palaeonemertea): characterization and implications for the phylogenetic position of Nemertea. Mol Phylogenet Evol. 2007, 43 (3): 1056-1065. 10.1016/j.ympev.2006.10.025.View ArticlePubMedGoogle Scholar
  10. Boore JL: Animal mitochondrial genomes. Nucleic Acids Res. 1999, 27 (8): 1767-1780. 10.1093/nar/27.8.1767.PubMed CentralView ArticlePubMedGoogle Scholar
  11. Wolstenholme DR: Animal mitochondrial DNA: structure and evolution. Int Rev Cytol. 1992, 141: 173-216.View ArticlePubMedGoogle Scholar
  12. Ojala D, Merkel C, Gelfand R, Attardi G: The tRNA genes punctuate the reading of genetic information in human mitochondrial DNA. Cell. 1980, 22 (2 Pt 2): 393-403.View ArticlePubMedGoogle Scholar
  13. Montoya J, Gaines GL, Attardi G: The pattern of transcription of the human mitochondrial rRNA genes reveals two overlapping transcription units. Cell. 1983, 34 (1): 151-159. 10.1016/0092-8674(83)90145-9.View ArticlePubMedGoogle Scholar
  14. Boore JL, Brown WM: Complete DNA sequence of the mitochondrial genome of the black chiton, Katharina tunicata. Genetics. 1994, 138 (2): 423-443.PubMed CentralPubMedGoogle Scholar
  15. Kim I, Lee EM, Seol KY, Yun EY, Lee YB, Hwang JS, Jin BR: The mitochondrial genome of the Korean hairstreak, Coreana raphaelis (Lepidoptera: Lycaenidae). Insect Mol Biol. 2006, 15 (2): 217-225. 10.1111/j.1365-2583.2006.00630.x.View ArticlePubMedGoogle Scholar
  16. Fenn JD, Cameron SL, Whiting MF: The complete mitochondrial genome sequence of the Mormon cricket (Anabrus simplex: Tettigoniidae: Orthoptera) and an analysis of control region variability. Insect Mol Biol. 2007, 16 (2): 239-252. 10.1111/j.1365-2583.2006.00721.x.View ArticlePubMedGoogle Scholar
  17. Lavrov DV, Brown WM, Boore JL: A novel type of RNA editing occurs in the mitochondrial tRNAs of the centipede Lithobius forficatus. Proc Natl Acad Sci USA. 2000, 97 (25): 13738-13742. 10.1073/pnas.250402997.PubMed CentralView ArticlePubMedGoogle Scholar
  18. Macey JR, Larson A, Ananjeva NB, Papenfuss TJ: Replication slippage may cause parallel evolution in the secondary structures of mitochondrial transfer RNAs. Mol Biol Evol. 1997, 14 (1): 30-39. 10.1093/oxfordjournals.molbev.a025699.View ArticlePubMedGoogle Scholar
  19. Yamazaki N, Ueshima R, Terrett JA, Yokobori S, Kaifu M, Segawa R, Kobayashi T, Numachi K, Ueda T, Nishikawa K: Evolution of pulmonate gastropod mitochondrial genomes: comparisons of gene organizations of Euhadra, Cepaea and Albinaria and implications of unusual tRNA secondary structures. Genetics. 1997, 145 (3): 749-758.PubMed CentralPubMedGoogle Scholar
  20. Negrisolo E, Babbucci M, Patarnello T: The mitochondrial genome of the ascalaphid owlfly Libelloides macaronius and comparative evolutionary mitochondriomics of neuropterid insects. BMC Genomics. 2011, 12: 221-10.1186/1471-2164-12-221.PubMed CentralView ArticlePubMedGoogle Scholar
  21. Cannone JJ, Subramanian S, Schnare MN, Collett JR, D'Souza LM, Du Y, Feng B, Lin N, Madabusi LV, Müller KM: The comparative RNA web (CRW) site: an online database of comparative sequence and structure information for ribosomal, intron, and other RNAs. BMC Bioinforma. 2002, 3: 2-10.1186/1471-2105-3-2.View ArticleGoogle Scholar
  22. Coleman AW: ITS2 is a double-edged tool for eukaryote evolutionary comparisons. Trends Genet. 2003, 19 (7): 370-375. 10.1016/S0168-9525(03)00118-5.View ArticlePubMedGoogle Scholar
  23. Miya M, Satoh TR, Nishida M: The phylogenetic position of toadfishes (order Batrachoidiformes) in the higher ray-finned fish as inferred from partitioned Bayesian analysis of 102 whole mitochondrial genome sequences. Biol J Linn Soc. 2005, 85 (3): 289-306. 10.1111/j.1095-8312.2005.00483.x.View ArticleGoogle Scholar
  24. Cameron SL, Johnson KP, Whiting MF: The mitochondrial genome of the screamer louse Bothriometopus (Phthiraptera: Ischnocera): Effects of extensive gene rearrangements on the evolution of the genome. J Mol Evol. 2007, 65 (5): 589-604. 10.1007/s00239-007-9042-8.View ArticlePubMedGoogle Scholar
  25. Rokas A, Holland PW: Rare genomic changes as a tool for phylogenetics. Trends Ecol Evol. 2000, 15 (11): 454-459. 10.1016/S0169-5347(00)01967-4.View ArticlePubMedGoogle Scholar
  26. Perna NT, Kocher TD: Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genomes. J Mol Evol. 1995, 41 (3): 353-358. 10.1007/BF01215182.View ArticlePubMedGoogle Scholar
  27. Lobry JR: Properties of a general model of DNA evolution under no-strand-bias conditions. J Mol Evol. 1995, 40 (3): 326-330. 10.1007/BF00163237.View ArticlePubMedGoogle Scholar
  28. Sueoka N: Intrastrand parity rules of DNA base composition and usage biases of synonymous codons. J Mol Evol. 1995, 40 (3): 318-325. 10.1007/BF00163236.View ArticlePubMedGoogle Scholar
  29. Bogenhagen DF, Clayton DA: The mitochondrial DNA replication bubble has not burst. Trends Biochem Sci. 2003, 28 (7): 357-360. 10.1016/S0968-0004(03)00132-4.View ArticlePubMedGoogle Scholar
  30. Hassanin A, Leger N, Deutsch J: Evidence for multiple reversals of asymmetric mutational constraints during the evolution of the mitochondrial genome of Metazoa, and consequences for phylogenetic inferences. Syst Biol. 2005, 54 (2): 277-298. 10.1080/10635150590947843.View ArticlePubMedGoogle Scholar
  31. Webster BL, Mackenzie-Dodds JA, Telford MJ, Littlewood DT: The mitochondrial genome of Priapulus caudatus Lamarck (Priapulida: Priapulidae). Gene. 2007, 389 (1): 96-105. 10.1016/j.gene.2006.10.005.View ArticlePubMedGoogle Scholar
  32. Jacobs HT, Elliott DJ, Math VB, Farquharson A: Nucleotide sequence and gene organization of sea urchin mitochondrial DNA. J Mol Biol. 1988, 202 (2): 185-217. 10.1016/0022-2836(88)90452-4.View ArticlePubMedGoogle Scholar
  33. Boyce TM, Zwick ME, Aquadro CF: Mitochondrial DNA in the bark weevils: size, structure and heteroplasmy. Genetics. 1989, 123 (4): 825-836.PubMed CentralPubMedGoogle Scholar
  34. Lunt DH, Whipple LE, Hyman BC: Mitochondrial DNA variable number tandem repeats (VNTRs): utility and problems in molecular ecology. Mol Ecol. 1998, 7 (11): 1441-1455. 10.1046/j.1365-294x.1998.00495.x.View ArticlePubMedGoogle Scholar
  35. Wilkinson GS, Chapman AM: Length and sequence variation in evening bat D-loop mtDNA. Genetics. 1991, 128 (3): 607-617.PubMed CentralPubMedGoogle Scholar
  36. Kolpakov R, Bana G, Kucherov G: mreps: efficient and flexible detection of tandem repeats in DNA. Nucleic Acids Res. 2003, 31 (13): 3672-3678. 10.1093/nar/gkg617.PubMed CentralView ArticlePubMedGoogle Scholar
  37. Ki J-S, Lee Y-M, Jung S-O, Horiguchi T, Cho H-S, Lee J-S: Mitochondrial genome of Thais clavigera (Mollusca: Gastropoda): Affirmation of the conserved, ancestral gene pattern within the mollusks. Mol Phylogenet Evol. 2010, 54: 1016-1020. 10.1016/j.ympev.2009.12.003.View ArticlePubMedGoogle Scholar
  38. Bernt M, Merkle D, Ramsch K, Fritzsch G, Perseke M, Bernhard D, Schlegel M, Stadler PF, Middendorf M: CREx: inferring genomic rearrangements based on common intervals. Bioinformatics. 2007, 23 (21): 2957-2958. 10.1093/bioinformatics/btm468.View ArticlePubMedGoogle Scholar
  39. Lavrov DV, Lang BF: Poriferan mtDNA and animal phylogeny based on mitochondrial gene arrangements. Syst Biol. 2005, 54 (4): 651-659. 10.1080/10635150500221044.View ArticlePubMedGoogle Scholar
  40. Stechmann A, Schlegel M: Analysis of the complete mitochondrial DNA sequence of the brachiopod Terebratulina retusa places Brachiopoda within the protostomes. P Roy Soc Lond B Bio. 1999, 266 (1433): 2043-2052. 10.1098/rspb.1999.0885.View ArticleGoogle Scholar
  41. Helfenbein KG, Boore JL: The mitochondrial genome of Phoronis architecta-comparisons demonstrate that phoronids are lophotrochozoan protostomes. Mol Biol Evol. 2004, 21 (1): 153-157.View ArticlePubMedGoogle Scholar
  42. Kim DW, Lee KS, Jee SH, Seo SB, Park SC, Choo JK: Complete sequence analysis of the mitochondrial genome in the earthworm, Perionyx excavatus. Integr Biosci. 2005, 9: A705-Google Scholar
  43. Boore JL: Complete mitochondrial genome sequence of Urechis caupo, a representative of the phylum Echiura. BMC Genomics. 2004, 5 (1): 67-10.1186/1471-2164-5-67.PubMed CentralView ArticlePubMedGoogle Scholar
  44. Mwinyi A, Meyer A, Bleidorn C, Lieb B, Bartolomaeus T, Podsiadlowski L: Mitochondrial genome sequence and gene order of Sipunculus nudus give additional support for an inclusion of Sipuncula into Annelida. BMC Genomics. 2009, 10: 27-10.1186/1471-2164-10-27.PubMed CentralView ArticlePubMedGoogle Scholar
  45. Waeschenbach A, Telford MJ, Porter JS, Littlewood DT: The complete mitochondrial genome of Flustrellidra hispida and the phylogenetic position of Bryozoa among the Metazoa. Mol Phylogenet Evol. 2006, 40 (1): 195-207. 10.1016/j.ympev.2006.03.007.View ArticlePubMedGoogle Scholar
  46. Kilpert F, Podsiadlowski L: The complete mitochondrial genome of the common sea slater, Ligia oceanica (Crustacea, Isopoda) bears a novel gene order and unusual control region features. BMC Genomics. 2006, 7: 241-10.1186/1471-2164-7-241.PubMed CentralView ArticlePubMedGoogle Scholar
  47. Bleidorn C, Eeckhaut I, Podsiadlowski L, Schult N, McHugh D, Halanych KM, Milinkovitch MC, Tiedemann R: Mitochondrial genome and nuclear sequence data support Myzostomida as part of the annelid radiation. Mol Biol Evol. 2007, 24 (8): 1690-1701. 10.1093/molbev/msm086.View ArticlePubMedGoogle Scholar
  48. Bandyopadhyay PK, Stevenson BJ, Ownby JP, Cady MT, Watkins M, Olivera BM: The mitochondrial genome of Conus textile, cox I-cox II intergenic sequences and conoidean evolution. Mol Phylogenet Evol. 2008, 46 (1): 215-223. 10.1016/j.ympev.2007.08.002.PubMed CentralView ArticlePubMedGoogle Scholar
  49. Simison WB, Lindberg DR, Boore JL: Rolling circle amplification of metazoan mitochondrial genomes. Mol Phylogenet Evol. 2006, 39 (2): 562-567. 10.1016/j.ympev.2005.11.006.View ArticlePubMedGoogle Scholar
  50. Bandyopadhyay PK, Stevenson BJ, Cady MT, Olivera BM, Wolstenholme DR: Complete mitochondrial DNA sequence of a Conoidean gastropod, Lophiotoma (Xenuroturris) cerithiformis: gene order and gastropod phylogeny. Toxicon. 2006, 48 (1): 29-43. 10.1016/j.toxicon.2006.04.013.View ArticlePubMedGoogle Scholar
  51. Maynard BT, Kerr LJ, McKiernan JM, Jansen ES, Hanna PJ: Mitochondrial DNA sequence and gene organization in Australian backup abalone Haliotis rubra (Leach). Mar Biotechnol. 2005, 7 (6): 645-658. 10.1007/s10126-005-0013-z.View ArticlePubMedGoogle Scholar
  52. Yokobori S, Fukuda N, Nakamura M, Aoyama T, Oshima T: Long-term conservation of six duplicated structural genes in cephalopod mitochondrial genomes. Mol Biol Evol. 2004, 21 (11): 2034-2046. 10.1093/molbev/msh227.View ArticlePubMedGoogle Scholar
  53. Sundberg P, Turbeville JM, Lindh S: Phylogenetic relationships among higher nemertean (Nemertea) taxa inferred from 18S rDNA sequences. Mol Phylogenet Evol. 2001, 20 (3): 327-334. 10.1006/mpev.2001.0982.View ArticlePubMedGoogle Scholar
  54. Thollesson M, Norenburg JL: Ribbon worm relationships: a phylogeny of the phylum Nemertea. Proc Biol Sci. 2003, 270 (1513): 407-415. 10.1098/rspb.2002.2254.PubMed CentralView ArticlePubMedGoogle Scholar
  55. Andrade SCS, Strand M, Schwartz M, Chen HX, Kajihara H, von Döhren J, Sun SC, Junoy J, Thiel M, Norenburg JL, Turbeville JM, Giribet G, Sundberg P: Disentangling ribbon worm relationships: multi-locus analysis supports traditional classification of the phylum Nemertea. Cladistics. 2011, 27: 1-19. 10.1111/j.1096-0031.2010.00316.x.View ArticleGoogle Scholar
  56. Roe P, Norenburg JL: Observations on depth distributions, diversity and abundance of pelagic nemerteans from the Pacific Ocean off California and Hawaii. Deep-Sea Res. 1999, 46: 1201-1220. 10.1016/S0967-0637(98)00109-5.View ArticleGoogle Scholar
  57. Palumbi SMA, Romano S, McMillan WO, Stice L, Grabowski G: The simple fools guide to PCR. 1991, Honolulu, Special publication Department of Zoology and Kewalo Marine Laboratory. University of HawaiiGoogle Scholar
  58. Boore JL, Brown WM: Mitochondrial genomes of Galathealinum, Helobdella, and Platynereis: sequence and gene arrangement comparisons indicate that Pogonophora is not a phylum and Annelida and Arthropoda are not sister taxa. Mol Biol Evol. 2000, 17 (1): 87-106. 10.1093/oxfordjournals.molbev.a026241.View ArticlePubMedGoogle Scholar
  59. Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R: DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol. 1994, 3 (5): 294-299.PubMedGoogle Scholar
  60. Lowe TM, Eddy SR: tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 1997, 25 (5): 955-964.PubMed CentralView ArticlePubMedGoogle Scholar
  61. De Rijk P, De Wachter R: RnaViz, a program for the visualisation of RNA secondary structure. Nucleic Acids Res. 1997, 25 (22): 4679-4684. 10.1093/nar/25.22.4679.PubMed CentralView ArticlePubMedGoogle Scholar
  62. Stothard P, Wishart DS: Circular genome visualization and exploration using CGView. Bioinformatics. 2005, 21 (4): 537-539. 10.1093/bioinformatics/bti054.View ArticlePubMedGoogle Scholar
  63. Tamura K, Dudley J, Nei M, Kumar S: MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol. 2007, 24 (8): 1596-1599. 10.1093/molbev/msm092.View ArticlePubMedGoogle Scholar
  64. Watterson GA, Ewens WJ, Hall TE, Morgan A: The chromosome inversion problem. J Theor Biol. 1982, 99 (1): 1-7. 10.1016/0022-5193(82)90384-8.View ArticleGoogle Scholar
  65. Bader DA, Moret BME, Yan M: A linear-time algorithm for computing inversion distance between signed permutations with an experimental study. J Comput Biol. 2001, 8 (5): 483-491. 10.1089/106652701753216503.View ArticlePubMedGoogle Scholar
  66. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG: The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997, 25 (24): 4876-4882. 10.1093/nar/25.24.4876.PubMed CentralView ArticlePubMedGoogle Scholar
  67. Castresana J: Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol Biol Evol. 2000, 17 (4): 540-552. 10.1093/oxfordjournals.molbev.a026334.View ArticlePubMedGoogle Scholar
  68. Giribet G, Distel DL, Polz M, Sterrer W, Wheeler WC: Triploblastic relationships with emphasis on the acoelomates and the position of Gnathostomulida, Cycliophora, Plathelminthes, and Chaetognatha: a combined approach of 18S rDNA sequences and morphology. Syst Biol. 2000, 49 (3): 539-562. 10.1080/10635159950127385.View ArticlePubMedGoogle Scholar
  69. Dunn CW, Hejnol A, Matus DQ, Pang K, Browne WE, Smith SA, Seaver E, Rouse GW, Obst M, Edgecombe GD: Broad phylogenomic sampling improves resolution of the animal tree of life. Nature. 2008, 452 (7188): 745-749. 10.1038/nature06614.View ArticlePubMedGoogle Scholar
  70. Struck TH, Fisse F: Phylogenetic position of Nemertea derived from phylogenomic data. Mol Biol Evol. 2008, 25 (4): 728-736. 10.1093/molbev/msn019.View ArticlePubMedGoogle Scholar
  71. Hejnol A, Obst M, Stamatakis A, Ott M, Rouse GW, Edgecombe GD, Martinez P, Baguna J, Bailly X, Jondelius U: Assessing the root of bilaterian animals with scalable phylogenomic methods. Proc Biol Sci. 2009, 276 (1677): 4261-4270. 10.1098/rspb.2009.0896.PubMed CentralView ArticlePubMedGoogle Scholar
  72. Paps J, Baguna J, Riutort M: Bilaterian phylogeny: a broad sampling of 13 nuclear genes provides a new Lophotrochozoa phylogeny and supports a paraphyletic basal Acoelomorpha. Mol Biol Evol. 2009, 26 (10): 2397-2406. 10.1093/molbev/msp150.View ArticlePubMedGoogle Scholar
  73. Paps J, Baguna J, Riutort M: Lophotrochozoa internal phylogeny: new insights from an up-to-date analysis of nuclear ribosomal genes. Proc Biol Sci. 2009, 276 (1660): 1245-1254.PubMed CentralView ArticlePubMedGoogle Scholar
  74. Stamatakis A: RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics. 2006, 22 (21): 2688-2690. 10.1093/bioinformatics/btl446.View ArticlePubMedGoogle Scholar
  75. Stamatakis A, Hoover P, Rougemont J: A rapid bootstrap algorithm for the RAxML Web servers. Syst Biol. 2008, 57 (5): 758-771. 10.1080/10635150802429642.View ArticlePubMedGoogle Scholar
  76. Miller MA, Holder MT, Vos R, Midford PE, Liebowitz T, Chan L, Hoover P, Warnow T: CIPRES (Cyberinfrastructure for Phylogenetic Research). 2009, Archived by website at:, []Google Scholar
  77. Ronquist F, Huelsenbeck JP: MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 2003, 19 (12): 1572-1574. 10.1093/bioinformatics/btg180.View ArticlePubMedGoogle Scholar
  78. Huelsenbeck JP, Ronquist F: MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics. 2001, 17 (8): 754-755. 10.1093/bioinformatics/17.8.754.View ArticlePubMedGoogle Scholar
  79. Nylander JAA: MrModelTest Evolutionary Biology Centre. 2004, Uppsala University: Nylander, []Google Scholar
  80. Katoh K, Kuma K, Toh H, Miyata T: MAFFT version 5: improvement in accuracy of multiple sequence alignment. Nucleic Acids Res. 2005, 33 (2): 511-518. 10.1093/nar/gki198.PubMed CentralView ArticlePubMedGoogle Scholar
  81. Abascal F, Zardoya R, Posada D: ProtTest: selection of best-fit models of protein evolution. Bioinformatics. 2005, 21 (9): 2104-2105. 10.1093/bioinformatics/bti263.View ArticlePubMedGoogle Scholar
  82. Lartillot N, Lepage T, Blanquart S: PhyloBayes 3: a Bayesian software package for phylogenetic reconstruction and molecular dating. Bioinformatics. 2009, 25 (17): 2286-2288. 10.1093/bioinformatics/btp368.View ArticlePubMedGoogle Scholar


© Chen et al; licensee BioMed Central Ltd. 2012

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
