Skip to main content

Table 1 Primers used in real-time PCR analysis

From: Identification of differentially expressed genes in SHSY5Y cells exposed to okadaic acid by suppression subtractive hybridization

Genes Primers (5'-3') Product (bp)
NEFM TGCCGGCTACATAGAGAAGG 62
  TCTCCGCCTCAATCTCCTTA  
TUBB CCCTCTGTGTAGTGGCCTTT 68
  CCAGACAACTTTGTATTTGGTCA  
SEPT7 CACAATGTTCACCATTTTTCAAC 82
  TCATTGAAGTTAATGGCAAAAGG  
SYT4 AAAGTTGTAAGGGGCCAATTC 70
  ACCTCAGCTGCTACCACCAT  
NPY CGCTGCGACACTACATCAAC 62
  CTCTGGGCTGGATCGTTTT  
TPR CCACCGAGCGAGGTGATA 67
  AGAAGAAAGGCGAAGACCAGT  
ACTB AAGTCCCTTGCCATCCTAAAA 91
  ATGCTATCACCTCCCCTGTG  
NM23A ACATCCATTTCCCCTCCTTC 92
  AGCTTCCCTCCAAACTATGATG