Skip to main content

Table 7 Primers used for qPCR

From: Inflammatory responses in primary muscle cell cultures in Atlantic salmon (Salmo salar)

Name1 Accession2   Sequence 5′ to 3′ bp3
EF-1α AF498320.1 F CAAGGATATCCGTCGTGGCA 327
   R ACAGCGAAACGACCAAGAGG  
RPL1 CB516726 F ACTATGGCTGTCGAGAAGGTGCT 118
   R TGTACTCGAACAGTCGTGGGTCA  
HPRT1 EG866745 F CCGCCTCAAGAGCTACTGTAAT 255
   R GTCTGGAACCTCAAACCCTATG  
IL-1β AJ223954.1 F GCTGGAGAGTGCTGTGGAAGAACATATAG 179
   R CCTGGAGCATCATGGCGTG  
Hepcidin NM_001140849.1 F CATTGAAAATCGTGCATTGG 150
   R AGGCCTTCATTCTCGGTTTT  
IGFBP-6 DQ190459.2 F GCTCAATAGTGTTCTGCGTGG 118
   R CTTGGAGGAACGACACTGCTT  
TNFα1 NM_001123589.1 F TGTGTGGCGTCCTCTTAGTAGCAGCTT 101
   R CTCCATTTTGTCCTGCATCGTTGC  
IGFBP-4 EU861007 F TGTCGTGCTGAGCTGCAGAG 129
   R TGGCTGGCACTGCTTGGCAT  
IGFBP-5.2 EU861009 F TTCTCCAGAGGAAGCTATGTTAG 170
   R TCAAGGCTGCTGACAGAGTG  
Myf5 TC97553 F CGCATACCGCTTTTACTTCC 245
   R TGATCATGAGAAACGTGAAGC  
High choriolytic enzyme TC63579 F ATCAATGGGGCTCATCTCAG 239
   R ATGAGCAAACACGCAGTGAC  
Atrogin-1 GU456729.1 F CGAGTGCTTCCAGGAGAATCTG 384
   R GTCTGAAGGAGCTCCTTGATGG  
  1. List of primers used in qPCR, all primers were checked to ensure that they had an efficiency of between 1.8 & 2.0. All except for Atrogin 1 were used for qPCR confirmation of the microarray.1Identity of the gene, 2 Accession number of the cDNA sequence, 3Size of PCR product produced by the primers.