Skip to main content

Advertisement

Table 7 Primer sequences for qRT-PCR analysis of differentially expressed genes

From: Identification of mechanosensitive genes during skeletal development: alteration of genes associated with cytoskeletal rearrangement and cell signalling pathways

Gene Primer sequence Amplicon length
Fgf4 Fwd CCGACGAGTGTAAATTCAAAGAAA 97
Rv TTCTTACTGAGGGCCATGAACA
Cilp Fwd AAAAAGACGGCTTTCCAAATCA 78
Rv GGCATAGATAGGCCCATTGC
Rxrg Fwd CGTTGAGTGGGCCAAACG 75
Rv CCTGCCCGGAGTAGAATGAC
Dll1 Fwd GACCGCCGCTTCCTAATAGG 74
Rv GCCCAGATGTTCAGCTTAATTCC
Spp1 Fwd CCCTCGATGTCATCCCTGTT 69
Rv TGCCCTTTCCGTTGTTGTC
Vstm2a Fwd GTGGAGCTCTTACCCGACAGA 73
Rv CATTGCCTTGGACTTTCACTGTAC
Figf Fwd GGTTGCCTGAAACAGAGTAGTAGGT 71
Rv AGCATTGCCCTTGGACTTTG
Fgf10 Fwd GGGCTGCTGTTGCTGCTT 94
Rv GGCCTCCTGTGACACCATGT
Sfrp2 Fwd CAGAGAGAGTTCAAGCGCATCTC 68