Skip to main content

Table 2 Primer list for real-time qPCR

From: Genome-wide microarray analysis of Atlantic cod (Gadus morhua) oocyte and embryo

Gene name Gene symbol Sequence (5′- 3′) Product length, bp
nanor nanor ATCCAATACCCAACGGTTCA 92
GCGATGAAATGGCTGAATCT
Heat shock 70 kDa protein 4 hsp70 TGAACAGCGCTATGAACCAG 117
TCATGATGGGGTTACAAGCA
Heat shock 90 kDa beta hsp90ba CGAGGAGCACTACAACGACA 181
GTCCTGCTTCTCCTTCATGC
Stress-induced-phosphoprotein 1 (Hsp70/Hsp90-organizing) stip1 CCGATGTCCTGAAGAGGTGT 141
TCATGGCTAAGGGGTAGTCG
Follistatin fst ACCTGGAAAGGACCAGTGTG 117
GCACTTTCCCTGGTACTGGA
Formin-binding protein 4 fnbp4 GCCTGACCTCCACAGATGTT 100
CAACACGGACATCTTCATCG
Keratin 12 krt12 GCCAAGACTGACCTGACCAT 188
GCCTCGTAGTGTTCCCTGAC
Ikaros ikzf ATGATCTCCGGGTCTGTGAG 165
ACACTTGAGCTTTCCGTCGT
Reference genes
ATP synthase subunit s mitochondrial ATP5s AACAGGGTGGACTATGAGAGGA 114
GTGATGCCAGCGTTCAAA
Eukaryotic translation initiation factor 3 subunit 3 gamma 40 kDa isoform CRA b eIF3 AGGACGACGCAGACTTTGAC 121
ACGAAGGAGCCGTAGAAGGT
Tetratricopeptide repeat protein 39C tpr39 GAAACGGGCTGAGAGACTGA 63
ATGACACCCAGGAAGCAGAG
Dehydrogenase/reductase SDR family member 11 dhrs11 GGAGACAGAGTTTGCGTTCC 128
GAGGGGCACTGAGGACATAA
Ubiquitin ubi GGCCGCAAAGATGCAGAT 69
CTGGGCTCGACCTCAAGAGT