Skip to main content

Table 4 Primers used for construction of DIG-labelled DNA probes

From: Living with an imperfect cell wall: compensation of femAB inactivation in Staphylococcus aureus

Primer Sequence (5'-3')
dltA- F TCAGGCGGTACATTAAATCTTGT
dltA- R TATGTGTTGTAAATCGTCGCACT
dnaK-F CGATGAGCCAAAAGTAATTC
dnaK-R TACTTCGAATACACCGTCAC
fmtC-F CCGTATGTCCTTAGTGTTAC
fmtC-R GCAGTACAATCCTACAAAAC
glnA-F AGATGGAACACCATTTGAAG
glnA-R AAACGTTAAAGTGCATACCG
glpF-F TAGACGGAAGTTTTGATTGG
glpF-R GGCAATTGGTCCTAAGATAG
opuCC-F TTGTCGTGTTTGTCTTATCG
opuCC-R ACGTATTCGCAAAACCATAC
pyrP-F TTATCACGGGATTAAGTACG
pyrP-R ACAATCGGAATCATTACAAG
pyrR-F AACGTACAGTGACGAGAATC
pyrR-R TAACTGCATTTCTTTGATCC
RNAII-F CGAAGACGATCCAAAAC
RNAII-R TTATCTAAATGGGCAATGAGT
RNAIII-F GTGATGGAAAATAGTTGATGAG
RNAIII-R GTGAATTTGTTCACTGTGTCG
sa1007-F TAATGAATCCTGTCGCTAAT
sa1007-R TTCAGTGTATGACCAATCGAA
saeR-F GACCCACTTACTGATCGTG
saeR-R CCTAATCCCCATACAGTTGTG
sarA-F AGGGAGGTTTTAAACATGGC
sarA-R CTCGACTCAATAATGATTCG
splA-F GAATTACCTGGTTGTGCATACG
splA-R GAAGACCTTGCGATAGTTCATG