Skip to main content

Table 7 Primer sequences used for PCRs

From: Gene profile analysis of osteoblast genes differentially regulated by histone deacetylase inhibitors

Gene Strand Primer Sequences Annealing Temp (°C) Product Length (bp)
Akap12 F 5' GCCAGTGAAGAACATGAGCAG 56 160
  R 5' CTATGCAATCTGCTTTGTCTTGG   
Ap4s1 F 5' GTACTTCAGCCGAGTGAGTG 56 202
  R 5' CTCTTCCTTGGCCTTCACAG   
Amphiregulin F 5' GACTCACAGCGAGGATGACAAG 56 249
  R 5' GCTTGGCAATGATTCAAC   
Fibroblast growth factor 7 F 5' CAGTTTGGAAAGAGCGACGAC 56 170
  R 5' GGCAGGATCCGTGTCAGTATC   
Frizzled-1 F 5' CAAGGTTTACGGGCTCATGTAC 56 180
  R 5' GTAACAGCCGGACAGGAAAATG   
Frizzled-4 F 5' CTGCAGCATGCCTAATGAGAG 56 185
  R 5' CGTCTGCCTAGATGCAATCA   
Interleukin 1 receptor-like 1 F 5' CCAGCCAGAGTGGAAGACTC 56.9 189
  R 5' CAGGTCAATTGTTGGACACG   
Psmb10 F 5' CTTTACTGCCCTTGGCTCTG 56.9 168
  R 5' GTGATCACACAGGCATCCAC   
Qpct F 5' GAGGAGGCACTGAAGGAGTG 53 162
  R 5' GAAGATCGGACTGGATGCTC   
Sdh1 F 5' CTGCCGATTCTACAAGCACA 56.9 183
  R 5' AGCAAAGTGACCATCCCAAC   
Slc9a3r1 F 5' CAAAGTGTCCCCTCACCAGT 56.9 209
  R 5' AATGAACCCAAGATGCCAAG