Skip to main content

Advertisement

Erratum to: ‘DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs’

Article metrics

The original article was published in BMC Genomics 2015 16:846

Unfortunately, the original version of this article [1] contained an error. In the Methods part, in the Design and Cloning of Plasmids section, a sentence was included incorrectly. The correct sentence can be found below

"The Insert-2 sequence was previously assembled from four 5'-phosphorilated oligonucleotides (IDT)".

Please also note in table S3 The oligo pDECKO_seq_R is lacking one nucleotide. The correct sequence is ATGTCTACTATTCTTTCCCC

Reference

  1. 1.

    Prat-Aparicio E, Carme A, Sala I, Bosch N, Guigo R, Johnson R. DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015;16:846.

Download references

Author information

Correspondence to Rory Johnson.

Additional information

The online version of the original article can be found under doi:10.1186/s12864-015-2086-z.

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Reprints and Permissions

About this article