Skip to content


  • Erratum
  • Open Access

Erratum to: ‘DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs’

  • Estel Aparicio-Prat1, 2, 3,
  • Carme Arnan1, 2, 3,
  • Ilaria Sala1, 2, 3,
  • Núria Bosch1, 2, 3,
  • Roderic Guigó1, 2, 3 and
  • Rory Johnson1, 2, 3Email author
BMC Genomics201617:215

Published: 9 March 2016

The original article was published in BMC Genomics 2015 16:846

Unfortunately, the original version of this article [1] contained an error. In the Methods part, in the Design and Cloning of Plasmids section, a sentence was included incorrectly. The correct sentence can be found below

"The Insert-2 sequence was previously assembled from four 5'-phosphorilated oligonucleotides (IDT)".

Please also note in table S3 The oligo pDECKO_seq_R is lacking one nucleotide. The correct sequence is ATGTCTACTATTCTTTCCCC



Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (, which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

Centre for Genomic Regulation (CRG), The Barcelona Institute of Science and Technology, Barcelona, Spain
Universitat Pompeu Fabra (UPF), Barcelona, Spain
Institut Hospital del Mar d’ Investigacions Mèdiques (IMIM), Barcelona, Spain


  1. Prat-Aparicio E, Carme A, Sala I, Bosch N, Guigo R, Johnson R. DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015;16:846.View ArticleGoogle Scholar


© Aparicio-Prat et al. 2016
