Skip to main content

Table 6 Primers used for qRT-PCR

From: Transcriptomic analysis of differentially expressed genes in the floral transition of the summer flowering chrysanthemum

GeneID Primer F (5’-3’) Primer R (5’-3’) Blast nr
Unigene12136_All ATGGAGGCTGTTGGAATGCA ACATGGCATACTCATGGCTACAT FKF1
CL11101.Contig1_All GAGGAGAAGAAAGTGGTGGTAGG CTGGTCGGGTTCCATTTGTC CONSTANS-LIKE 16
Unigene15244_All ACCCGGTCAGATGCTAAGATGT AGAAAAGCCATTATTCGCACC MYB transcription factor
CL7046.Contig5_All AGGCAAAAAGGAGTCTGCAA ACCATTGATGAAGCACCACA CONSTANS-LIKE 9
CL9282.Contig2_All TGTGGACAATGAGTGGCGTT TGTCAGCCCTGTAATGCTTCTG gibberellin 20-oxidase1
Unigene15909_All AGGGTTTGTTCCGATTGTAACA TTGGTTTCTCCTGCTGCTTCT GATA transcription factor
Unigene33409_All AAAGGCATCTCAAGGGAGAAGA TTGCTGCTCTACCAGATGTTGC APETALA1 protein
CL4112.Contig3_All GGGCAAAGATTGAGGTCCTAGA GTAACACAAACCCTGCATTTCG Agamous-like 18