Skip to main content

Table 2 Genes used in “NeoVigen96” chip that were analyzed in the Biomark HD system, classified according to functions and pathways

From: High-throughput gene-expression quantification of grapevine defense responses in the field using microfluidic dynamic arrays

Gene Functions Gene Names N° accession Primer Sens - 5′ > 3′ (F) Primer AntiSens - 5′ > 3′ (R) PCR efficacies
Reference genes Elongation factor1 chain γ EF1γ a AF176496 GAAGGTTGACCTCTCGGATG AGAGCCTCTCCCTCAAAAGG 1.09
Serine/threonine-protein phosphatase 2A PP2A XM_002276144 TCCGGCGGCTCTCGACGATT TTCGCGTGCTCAACACCTCCG 0.97
SAND family protein (endocytosis) SAND XM_002285134 GCCCCACAGCCAAACCCCTC ACGATCCGTTTGCGACCCCG 1.05
Pentatricopeptide repeat-containing protein Unknown XM_002274855 TGGTGAACTTGAGGCTGCAAGGG ACCATTTGGGGAGTAGCCCTTCCTC 1.01
Ubiquitin Conjugating Enzyme 9 UBC9 XM_002274238 TCCTCCTGACAGTCCATATGCTGGT GGGCTGGGCTCCACTGCTCC 1.00
TIP41-like protein TIP41 XM_002270674 CAGCGGGCAGCGATCGAAGA CATTTCCGCTCCGGCAGCCTT 1.05
Catalytic thioredoxin-like protein 4A THIORYLS8 XM_002283586 TCACTCTGGATGGGCCGTCG TCCCAATCGTGGCCGAACCG 1.14
Tubulin alpha TuA XM_002285685.1 GTCGGCGCTGAAGGTGTGGA GAGGTGGCGGGCAAACCCTC 0.97
Tubulin beta βTub XM_002275270.1 TGAACCACTTGATCTCTGCGACTA CAGCTTGCGGAGGTCTGAGT 0.99
TuB XM_02275270.1 CGCCACCCGAGTCTCACTGC CACACCGTGCTCGTCGCAGA 1.04
Glyceraldehyde 3-phosphate dehydrogenase GADPH XM_002263109.1 GAAATCAACGGCCCAGCGCG CCGGTGGATACTGGGGCGGA 0.83
PR protein PR1 Unknown function PR1 a AJ536326 CCCAGAACTCTCCACAGGAC GCAGCTACAGTGTCGTTCCA 1.00
PR1 bis XM_002273752.1 GGGGTTGTGTAGGAGTCCATTAGCA TGGGCACAGCAGATGTGAGCT 1.13
Beta-1,3-glucanase GLU a AF239617 GGGGAGATGTGAGGGGTTAT TGCAGTGAACAAAGCGTAGG 1.18
PR2 XM_002277475 CAACTTGCCACCGCCAGGGC AGGGCTTGGAGAGCAGCTTGG 0.96
Endochitinase (Chitinase type I, II, IV,, VI and VII) PR3 U97522.1 ACTACGGCGCTGCTGGAAACA TGGCACCGAAACCTTGGCTTAG 1.16
CHIT4a a U97521.1 TATCCATGTGTCTCCGGTCA TGAATCCAATGCTGTTTCCA 1.14
Chitin binding Chitinases type I, II PR4 XM_002264684.1 CCCAGAGCGCCAGCAATGTGA TTGCTGCGCCATGCCAAGGG 0.95
PR4bis XM_002264611.1 TGGCTACTGCGGAACAACGGC CAAGTGGCGCAGTAGGCGCT 1.02
Thaumatin-like/Osmotin PR5 XM_002282928.1 GGAGGCAATGGTTTCCACCTTGGG ACTTGGACGGGACCATAGAGGTTAG 0.99
PR5bis XM_002282874.1 CCCCGGCACCACCAATGCTC TGGGGGAGAACCGTAGCCCTG 1.18
Proteinase inhibitor PIN a XM_002284418 ACGAAAACGGCATCGTAATC TCTTACTGGGGCACCATTTC 1.23
PR6 XM_002277772 TGGGAAGCAGGCTTGGCCTGA ACCTGGCTCTCACCGAAGGG 0.99
PR6bis XM_002280597.1 GCCAGAGCTGGTGGGCGTAC AGGCGCCATACTCACGATGCC 1.10
Subtilisin-like endoprotease PR7 XM_002275435.2 TGCTCCCAATCATGGTGGCTGT TGAAGACTCTGCGGTGTGTCCT 1.01
PR7 bis XM_002275435.1 CGTTAAGCAGCTGGAAAGGAGCA TCCTCCGTCAGTCTGGCTGCAA 1.04
Chitinase type III CHIT3 a Z68123 AATGATGCCCAAAACGTAGC ATAAGGCTCGAGCAAGGTCA 0.98
PR8 XM_002276329 GCAACAAAGCTCAATGGCACACCAC CAGCCAAGCTGCCCTCGTTCC 0.96
Lignin-forming peroxidase POX a XM_002285687.1 ACTGCACCAAGAAAGAGCACCAG AGCTGTGCATGTGCCATCCCC 1.14
PR9-b XM_002285613.1 AGCGAGCGAGAAAGACGCGA GAGACGACGCCTGGGCAGAC 0.91
Ribonuclease-like PR10 a AJ291705 GCTCAAAGTGGTGGCTTCTC CTCTACATCGCCCTTGGTGT 0.99
Chitinase type I PR11 XM_002270543.1 CTCCACTGCGCAAACCGTGGT TTTGCGTTTTCGGAGGAAATCGTGA 1.10
Defensin PR12 XM_002281153 GTGCAAGAACTGGGAGGGTGCC GCAGAAGCATGCAACTCCCGGG 0.88
Lipid Transfer Protein PR14 XM_002271080 ACAGTTGATCGCCAGGCCGC GCCCGGAAGCCCACTTGCAA 1.18
PR 14bis XM_002270934 CGCCACCACACAAGACCGCA AGGGAGGCCAGCAGCCAGAC 1.01
Germin-like Protein- Oxalate oxidase PR15   GTTTCCTGGCCCTCATGGAATTGGC GTGTCCTGCAGTGGGCTTGGA 1.19
PR15bis XM_002284176.1 GCCATGGCAGATGATTTCTT TGCAATTTGGGCAACATTTA 0.87
Polygalacturonase Inhibiting Protein PGIP a XM_002263487.1 GAGCGATGCCACCCCAGTGA CCGTTGAGTCGGACGCTCGAC 0.96
Secondary metabolites biosynthesis Phenylalanine ammonialyase PAL a X75967 ACAACAATGGACTGCCATCA CACTTTCGACATGGTTGGTG 1.10
Stilbene synthase (resveratrol synthase) STS a X76892.1 ATCGAAGATCACCCACCTTG CTTAGCGGTTCGAAGGACAG 0.95
Resveratrol O-methyl-transferases ROMT FM178870 TGCCTCTAGGCTCCTTCTAA TTTGAAACCAAGCACTCAGA 0.96
ROMT2 XM_002281445.1 TCCACACTGCTTACGAGCGGT CAACCCCGCAAATACGCCCTGG 0.99
Chalcone Synthase CHS a X75969.1 CCAACAATGGTGTCAGTTGC CTCGGTCATGTGCTCACTGT 1.01
CHS2 XM_002276885.1 GCATTTTCCGACGAAGTTCACACTG GTGCCGATGGCCAGAACCGT 1.04
Chalcone Isomerase CHI a X75963 AGAAGCCAAAGCCATTGAGA CCAAGGGGAGAATGAGTGAA 1.04
CHI2 XM_002280122 TGTGGGCCATCTGCAACCATGG GCACTCTCTAGCTGCACCCCG 1.12
Dihydro Flavonol Reductase DFR XM_002281822.1 GGCCACCGTTCGCGATCCAA GAAGACGCCGGTGCAGCCTT 1.05
Anthocyanidine synthase LDOX a X75966 TGGTGGGATGGAAGAGCTAC CCCACTTGCCCTCATAGAAA 0.84
Polyphenol Oxidase PPO XM_002275806.1 GGTCCCTCGTTATGGGGCCGA CCTGGATGGAAATCAGGGCGCC 0.98
3-hydroxy-3-methylglutaryl Coenzyme A reductase HMGR XM_002275791.1 AACGCACACTCCGCTCCACG GCGGCGGCGATCTTCATCGA 0.93
Farnesyl Pyrophosphate Synthase FPPS XM_002272605.1 TCGCCAATGGGTCGAGCGTA TGCCTGCCTTGCAGCAACTTGT 1.03
(E,E)-alpha-farnesene synthase FAR XM_002281343.1 GCCATGGCACTCCACCTCTCCTAA AGGCGGGCTGGTAATGCGCT 0.99
FAR2 XM_002264969.1 TTGCGAGGCAGAAGCTGGCC TTTGGCCCACGAAAGGCGGG 1.08
Flavanone-3-hydroxylase F3H a X75965.1 TGACTCGCTCTCTTCAAGCA CACCTTGGGACGTTCATCTT 0.87
F3H bis XM_002275553.1 TCCAGCCCGTGGAAGGAGCA TGCTCAGATACTGCCCACCCAA 0.96
Carboxylesterase HSR-203 J XM_002285050.1 TGGAGGAAACATCGTTCACA CCTGGACAATTCTGCCATCT 1.02
Indole biosynthesis Antranilate Synthase ANTS a XM 002281597 AAAAATCCAAGAGGGGTGCT AAGCTTCTCCGATGCACTGT 0.84
Chorismate mutase CHORM a FJ604854 TCATTGAGAGGGCCAAATTC AGGAGGCAGAAAAAGCATCA 1.05
CHORM2 XM_002284083.1 GGCAAGTTCGTGGCAGAGGCA GCCGCTGGCTGTCTTGTGCT 1.11
Chorismate Synthase CHORS a FJ604855 GCCTTCACATGCAGATGCTA CTGCAACTCTCCCAATGGTT 1.00
CHORS2 XM_002282263 TGTTATGGCGCGCGGTGACT GCAGCTCTGGCCAGTTGAGCT 1.11
Redox status Glutathione S-transferase GST1 a AY156048.1 GGGATCTCAAAGGCAAAACA AAAAGGGCTTGCGGAGTAAT 0.99
GST2 AY156049 CATGAAGGCCGGCCAGCACA CGCGAAGAATTCGCTCTGGCCA 0.84
GST3 XM_002283178 TGTTTGGCCGCAAACGGGGT TCCCCAGCCAGGTACTTGCTCT 1.06
GST4 XM_002271673 AGCTGGAATGGCGCACTTGGT TGGAAAGGTGCATACATGGCCACG 1.00
GST5 XM_002283173 CCTTGAGCTCTACCCTGCCCCA AGCAGCCAGCCCTAGACATGGA 0.86
Oxylipines Lipoxygenase 13 LOX2 XM_002285538 AAACCGTGCATTCCCGGCCC GGCAGGGACGTAGCCAACCC 1.02
LOX3 XM_002284499.2 GGACCGGGTTCATGAGCTGTTGG TGAATGCAGACTCGCCAGCGGT 1.09
LOX4 XM_002280615.1 CCACAAGCGAAGGCGGGCTT AGCAATGTGCATTTCAGCCATCGA 1.10
Lipoxygenase 9 LOX9 a AY159556 GACAAGAAGGACGAGCCTTG CATAAGGGTACTGCCCGAAA 0.92
Cell wall reinforcement Alliinase Alli XM_002265837.1 CGGCTCAGCCTCATCAAGACCC GGCATGCATGTCATCTTCCTCAGCC 1.04
Alli2 XM_002266017.1 AGCCCTTCTGGATGCAGCATGC TGTAGCTTGCGGATGAGCTTCACT 1.00
Ascorbate peroxidase APOX XM_002284731.1 AGCTCAGAGGCCTCATCGCTGA TACCGGCAGAGTGCCATGCG 1.07
APOX2 XM_002278245.1 TCGAAGCTCAGCAGACGCCG ACGTCCCCGCATCATGCCAC 1.14
Glycosyl transferase (Coniferyl alcohol glucosyl transferase) CAGT a XM02273320.2 TCGGAAGGGAATGCAATAAG TGTAGGAGGAACCACCCTTG 0.81
CAGT2 XM_002276999.1 TGTTCATGAGGGCTGCGCCG CACCAGGCAGCTCACTGGCC 1.00
Callose Synthase CALS a AJ430780.1 TGGAAATGCAATTCAAACGA CGAATGCCATGTCTGTATGG 0.86
CALS2 XM_002283262 (CS-like 12) ATGGCGTCCAGAAGCGGCTC GCCGTCTGTGTCCGCGTGAT 0.86
CALS3 XM_002285608.1 (CS-like-10) GCAGCAGATTGCCACTGCCCA AGGCAGAATGAGGTGCTCGCC 1.14
Lignin-forming peroxidase PER a XM_002274762.1 TAAGCGCCACAAGAACACTG GGACCTCCTTGTTGAGTCCA 0.93
Pectin methyl esterase PECT1 XM_002275783.2 TGTTGGCCTCGAGGAGAGGGG GGGAGGCCTACAGACCAAAAGTCA 1.18
PECT2 XM_002283905.1 GGGTTGCGCCCTGAGGACAC CAATCACCCGAGCCGCCTGG 1.08
CAD Cinnamyl alcohol dehydrogenase CAD XM_002285332.1 AGTCCGATTGGAAGACGGCAGT TGCCCCTGTCACACACACCA 1.05
CAD2 XM_002268086.1 TCCGGGTATCCCAGGAGAAAGCA TCCACGGTATCCTTCATGCTCACC 1.07
Signaling SA Methyl Transferase SAMT1 XM_002262982.1 AATCCTTGCCCAAGTTCCAG GAGACAACCATTGGAGACTG 1.16
Allene Oxide Synthase AOS1 XM_002281190.1 TTATGGCTTGCCCTTCTTTGG ATGGAGTCGAGGAGGACGAT 0.94
Lipase 3/enhanced disease susceptibility 1 EDS1a XM_002281059.1 CAGGTCACAGCCTGGGTGCG TCGGGCGGGACGATCTCGTT 1.01
EDS1b XM_002281871.1 GGAGACGGGGCTGAACGTGC CCATCGCCGGCACTTGCTCA 0.89
EDS1c XM_002275822.1 CCAGCACTGCTTGCAGGCGT TGCTGTGTTCCTGAGTGCCCC 1.04
Transcription Factors WRKY1 AY585679.1 GGAAATATGGGCAGAAAGCA ATCTTTTGAGAGGCGTTGGA 1.00
WRKY2 AY596466 AGAGGCAAGGCGATGTAGAA CTGGGGAACAAGCCTTCATA 1.01
JAR = Jasmonate-resistant 1 JAR XM_002283193.1 GCAACGGGGCACGACTACTGT GCCGTGGCGGTGCAAGTACT 0.89
JAR2 XM_002280702.1 CCGAAGTGCTGGCCCCAGAG AACGCTCACTTCGCCGCTGA 1.00
JAR3 XM_002268242.1 GGAGCAATGCTGCTCCACAGTGG GGCGTCGAATGTGCCAGGCT 1.01
ACCO 1 ACO1 XM_002273394.1 GCCGGTTTGAAGTTCCAGGCCA ACTCAAACTGTGGCAATGGGACCC 1.06
ACO1b XM_002275305.1/XM_002275284.1 CGAGCCCACACTGATGCCGG TTGAGGAGCTGGAGGCCGCT 1.00
ACC a AF424611 GAAGGCCTTTTACGGGTCTC CCAGCATCAGTGTGTGCTCT 0.86
EIN3-Binding F Box Protein 1 EIN3 XM_002285090.1 TTGGCTCTGAACGCGTCCGA CCCCGGGGCAGAAGGCATCA 0.88
EIN3bis XM_02285213.1 CCTCGCAAGCGGTCTCGCAT TGGAGACCCGAGCGCAGGAG 0.98
  1. aGenes also included in the “BioMolChem” chip