Skip to main content

Table 2 Primers used to validate the architecture of the Porphyromonas gingivalis genome

From: Genomic repeats, misassembly and reannotation: a case study with long-read resequencing of Porphyromonas gingivalis reference strains

Primer Name Primer sequence (5' to 3') Tm (°C)
rrn1F TCCCCACCGGCAAAAACATC 68.0
rrn1R GAGATGTCCGAAAGTCCATGTCAC 66.3
rrn2F AGATAGCCAGTTTCGTTACGTCCG 67.3
rrn2R TACAGCAACGGTTACTTCCGCG 68.6
rrn3F CTATGGATATTCTGCGGTGTACGG 66.3
rrn3R GTTGTAGGACAGCAACCTTTTGG 64.2
rrn4F ACAAGTCAGAACATGGCCGAT 64.3
rrn4R CAGGCACAAACCGCTTTACC 65.0
ctnpg1_5out1 GACGGAATTTGCGTGTTGATATAGT 64.3
ctnpg1_5out2 ATAAACGTGTGGCCGAAATAGATTC 65.3
ctnpg1_5in CAATAGCGTTTGCATTACCTCATCT 65.3
ctnpg1_mid ATCGGTGGAGATGTTCATACTACTG 63.9
ctnpg1_3in GTATTTGCCCAATACTCTCTGAACG 64.9
ctnpg1_3out1 CGACAACATCGTATTTCTCTGTCAG 64.9
ctnpg1_3out2 CACCGAGATTCAAGGTTATGTGATG 66.9