Skip to main content

Table 1 Novel microRNAs identified in bovine monocyte-derived macrophages with or without challenge with lipopolysaccharides (LPS), Streptococcus agalactiae strains ST103 and ST12

From: MicroRNA expression profiles of bovine monocyte-derived macrophages infected in vitro with two strains of Streptococcus agalactiae

provisional ID mature read count star read count miRDeep2 score example miRBase miRNA with the same seed consensus mature sequence precursor coordinate
chr25_2078 63,905 8,00 32,589,40 mmu-miR-106b-3p ccgcacuguggguacuugcugc chr25:36892057..36892117:+
chr8_3368 48,256,00 44,00 24,641,00 hsa-let-7d-3p cuauacgaccugcugccuuucu chr8:86887438..86887514:+
chrX_3864 40,373,00 6,00 20,590,60 hsa-miR-223-5p cguguauuugacaagcugaguug chrX:99936328..99936387:-
chr7_3248 14,956,00 13,00 7636,00 mmu-miR-24-1-5p gugccuacugagcugaaacacag chr7:12981645..12981702:-
chr26_2162 10,315,00 54,00 5290,60 eca-miR-146b-3p ugcccuagggacucaguucuggu chr26:22930915..22930975:+
chr11_440 4397,00 11,00 2251,80 ssc-miR-181d-3p accaccgaccguugacuguacc chr11:95709449..95709509:+
chr8_3359 3633,00 95,00 1990,00 mmu-miR-27b-5p agagcuuagcugauuggugaaca chr8:83009841..83009902:+
chr25_2117 3826,00 7,00 1958,50 gra-miR7486h cagcaacuaaagaucccucagg chr25:34409297..34409357:-
chr22_1816 3325,00 78,00 1741,70 bmo-miR-3000 cugcgcuuggauuucguuccc chr22:51543484..51543548:+
chr3_2544 1854,00 9,00 951,00 bta-miR-2285f aaaaaccugaaugacccuuuug chr3:94548590..94548649:+
chr8_3366 1064,00 754,00 932,60 hsa-let-7a-3p cuauacaaucuauugccuuccc chr8:86885231..86885309:+
chr7_3219 1392,00 74,00 748,70 hsa-miR-378a-5p cuccugacuccagguccugugu chr7:63067305..63067362:+
chr3_2643 863,00 137,00 513,90 hsa-miR-30c-2-3p cugggagaggguuguuuacucc chr3:106059376..106059437:-
chr16_1041 937,00 11,00 486,50 hsa-miR-181a-3p accaucgaccguugauuguacc chr16:79685955..79686018:-
chr14_712 672,00 34,00 364,10 hsa-miR-30a-3p cuuucagucagauguuugcugcu chr14:8080297..8080360:+
chr1_143 643,00 10,00 335,60 mmu-miR-15b-3p cgaaucauuauuugcugcucuag chr1:107923396..107923457:-
chr12_549 565,00 17,00 301,20 hsa-miR-92a-1-5p agguugggaucgguugcaaugcu chr12:66227265..66227321:+
chr1_111 475,00 6,00 249,50 mmu-miR-125b-2-3p acaagucaggcucuugggacc chr1:19881359..19881419:-
chr16_1003 359,00 103,00 240,00 efu-miR-9283 uguggccucuggguguguacccuc chr16:33022297..33022356:-
chrX_3750 463,00 6,00 240,00 ssc-miR-374a-3p uuaucagguuguauuguaauu chrX:81951234..81951286:+
chr18_1154 297,00 42,00 181,00 hsa-let-7e-3p cuauacggccuccuagcuuucc chr18:58015043..58015110:+
chr4_2734 287,00 41,00 168,50 acacgcguccuuggauccugacu chr4:119142851..119142912:+
chrX_3767 228,00 37,00 139,50 hsa-miR-222-5p cucaguagccaguguagaucc chrX:103538171..103538234:+
chrX_3861 197,00 16,00 113,20 hsa-let-7a-3p cuauacaacuuacuacuuuccc chrX:96382645..96382725:-
chr19_1372 157,00 5,00 82,60 agggagucccugguaguucagu chr19:46741763..46741851:-
chr19_1308 103,00 22,00 65,00 ccccggcuuuuccucccccagg chr19:62308493..62308542:+
chr5_2875 86,00 8,00 52,80 ssc-miR-7134-5p auguccgcggguucccugucc chr5:112083860..112083922:+
chr19_1281 70,00 5,00 43,00 hsa-miR-152-5p agguucugugauacacuccgacu chr19:39081179..39081236:+
chr18_1135 13,528,00 95,00 5,60 mmu-miR-140-5p cagugguuuuacccuaugguag chr18:37088153..37088219:+
chr19_1237 93,00 15,00 5,40 ahy-miR3511-5p accagggcuggaagcugcuucu chr19:9534051..9534107:+
chr2_1498 1928,00 20,00 5,30 hsa-miR-26b-3p ccuguucuccauuacuuggcucg chr2:107133408..107133466:+