Skip to main content

Advertisement

Table 1 Comparative primers used for the identification of positive BAC clones in the MHC regiona

From: A high-density BAC physical map covering the entire MHC region of addax antelope genome

Name Gene symbol Primer sequence (5′ → 3′) Product (bp) Positive addax BAC clones
S0 MOG F: TGCATGCTGAGACTACACCA 572 97H9;427 M6
R: CTGAACTAGGACAGTGCAGG
S02 PPP1R11 F: AGAACCGGAGCCTAACCATC 641 97H9;427A11; 372A2
R: CCGCACACAGTGTGTATGAC
S03 TRIM10 F: ATGTGTGTGACCATGAGGCT 650 427A11;470I19
R: TCAGTCTAGTCGCATCCGAG
S04 TRIM26 F: CCTTGCATGAAGTCAGCTTG 919 470I19
R: CCACCTCTGAGCTGAATGAA
S05 OLA-I F: ACACCGCACTCGGCTACTAC 332 273H17;419 N6; 493 K20
R: GCGATATAATCTCTGCCGTC
S06 LOC101110710 F: AGATCTCCAAGCTCAAGCCT 805 none
R: TGTGTGTCTGACAGCTGCGA
S07 ABCF1 F: GCGAAGCCAGAGTTACCATA 1119 427P1;392 L11; 51E6
R: CCACAGCATTCTCAAGCACA
S08 ATAT1 F: ATAGTGTGAAGGCCATGAGG 908 427P1;427H1; 397 K7
R: GCTCAAGTTCTTGGATCGGT
S09 NRM F: GCTTGAGAGTGCCTTGGTAA 514 350H17
R: ATGAGCTCTGCGTAGTCGAA
S10 FLOT1 F: GCACAGAAGTTGTCAGCACC 911 350H17;297P6
R: TCGTCATTCTCTCTGGAAGC
S11 DDR1 F: GACTCCATGTTGTGCAGGCT 1114 97P6;206A17; 132D20
R: GTCCTCACCTGGCATTCTTG
S12 DPCR1 F: CTAACATCACAGAGGCAAGC 1129 none
R: TAAGTGAATGTGTGCGGAGC
S13 CDSN F: CAGTAACGCTGTGAGGAAGG 830 395 M8;132D20; 205C9
R: GAGATGGCAGCTTATTCTGG
S14 POU5F1 F: CTCGGACCTGGATGAGCTTC 1256 345 K6;395 M8
R: TATTCAAGGCTCAGCAGTCG
S15 MICA F: AACTCCTGGCAGAGATCTTG 1064 345 K6;368L6
R: CTCACTGTCCACTTCTGGCT
S16 LOC101105609 F: CTCAACAGAGTTCGCGATCA 851 none
R: AAGCTAGAGTCTGGCCTCCT
S17 MCCD1 F: GGCTCACCAGTTCAACCAAG 747 217P17
R: CACTGCGTGTAGAGCTCGTC
S18 TNF F: GGAACCAGAGGATAAGCTGA 980 217P17;269 L19
R: TCATCTGGAGGAAGCGGTAG
S19 APOM F: ACGACGCCAATCACAGTAAG 986 145D13
R: CTCAACGAGGACGATGGTAA
S20 LY6G6C F: GGATGTGGTTCACCTGGTCA 904 493O11
R: CGTGGAGGTTACACACTTGC
S21 VARS F: CTTGGACTGGAATCGAGCCT 839 none
R: AGCCTTGGACCTTGTAAGCA
S22 HSPA1A F: CTACGTGGCCTTCACCGATA 1214 493O11;383F23
R: CCTCGTACACCTGGATCAGC
S23 C2 F: TGTGATAATCGTCCAGCTCC 1549 299D13
R: CCGATGGCATAGATGTCTGA
S24 STK19 F: GGATTGTCCAGCTAGGCTTC 1182 none
R: CCTACACACACCTCACCACG
S25 TNXB F: CCAGATGTGCATACCACTCA 942 218D15;120D3
R: GGTGTGCTCAGCATCTTCCT
S26 PBX2 F: GATAATGACCATCACCGACC 1074 279C4;500O21
R: CCAGAGTTGAGGAATCGGAG
S27 NOTCH4 F: TCCTGGTACTCCATTCTTGC 1006 279C4;500O21
R: GATTGACACGCGTCTGGTTC
S28 LOC101111058 F: ACCAGGTGACTGTCCAGAGG 1117 53B21;301E21
R: GTGAAGTACAGGCCAGCTCC
S29 LOC106991808 F: GCTGCCCATCTGTCCACGA 658 485B7;430H19
R: AATTCAGTTGAAAGGCACACT
S30 C20H6orf10 F: CACACGTACCTTCGGCTCT 616 415H14;82H18; 55D19
R: ATTCTTCTGTCCACGCACT
S31 LOC105603755 F: TTCCCTTTCAGGTTCTCACCA 441 390I7;292P1
R: TGCACAGTTATGATTGTTGGAC
S32 LOC105603754 F: AGCTTCTTTGTGAAAACGCAT 499 424B10;146 M21
R: GCTATTCCCCGTGGATACCAAA
S33 LOC101110546 F: CTTTGGATACAGTTACGCTCCT 944 392G17;478N22
R: ACCAATGAAACAGAATAGAGCC
S34 LOC105603751 F: GAAGGCGTCAGTCCATACCC 707 none
R: ACAGAGCCTTATGGTTCCGAA
S35 LOC101110277 F: GCCTCATCCGACAGCACCG 795 420O12;368E9
R: CCTTTCCTTGTGCTACGCTT
S36 BTNL2 F: CCTCTCGCTCTGCTATGGTT 861 473F22;473H22; 233P9
R: CAGAAGGCATGCACCACTTA
S37 LOC101120871 F: GGTGAACACGGTGTGCAGAT 907 244 M7;392G17
R: ACCATGAGTTGTGCAGCTGA
S38 DQA F: CAGGAGTATTGCTGAGCAGG 1274 244 M7;247O24
R: TGACAAGGACAGTGGCAATG
S39 OVAR-DRB3 F: GACAGGAGCTAGATTGGACC 924 1 M15;372C2
R: CCATGACAGCCTGCACATAC
S40 LOC101120118 F: AGGCAACGTCCAATGGTACT 1321 385F12;381B3
R: CATGAATCCGCTGCATTCTC
S41 LOC101109220 F: ATGATGACATCTGGCACAGG 970 385F12;401K6
R: CAACAGAGGTATGAGCCAGG
S42 OVAR-DRB1 F: CCTGTAATGGAAGTCCTCTG 1272 432 J13;134D8
R: GCCAACTTGCTCTCTATGCT
S43 ELOVL5 F: CAGTGCATGGACCTACGAAC 1562 134D8;276 J2
R: CAGGAGGCAGATCTACATGA
S44 GCM1 F: TTGGAAGAGCTAGGAAGCAC 1151 276 J2;466O4
R: CTCGAGTCACCAGATCCTTG
S45 VPS52 F: CGCTTGAAGGATTGGTGACT 930 444E20
R: GACCATGATCTGCACTCAGG
S46 RXRB F: TGTACAGGAGGAGCGTCAGC 973 354 J10
R: GGTGAGGTCAACGAGACTGG
S47 LOC101110545 F: TCTTCTCATCTCGCACACAG 982 none
R: GAAGAAGCAGGCCTTGAATC
S48 BRD2 F: CTGTATACTCCACCGCCTGA 900 270A14
R: GTGTGTGTGGCCTCCAACTA
S49 PSMB9 F: ACCAGATAACCTTGAGCCAG 869 176F14
R: AGGATCATACAGCGAGTTGC
S50 DYA F: CGAGCTCTTCTACGTGGACC 1037 94B2
R: GACCACAGCTTCCTCGTTCT
S51 GCLC F: TGATGGAACATCAGGCCTAC 841 68 K22;427 K6
R: GAGAAGGCGTCCGACTATAA
  1. aThe comparative primers were designed with bovine and ovine MHC consensus sequences as templates. A total of 51 pairs of primers are listed here