Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 5 Primer information

From: What determines host specificity in hyperspecialized plant parasitic nematodes?

Gene SeqID Sequence (5′3’) forward/reverse
RBP-1 GROS_g14179.t1 GACGCCGTTTGCTTGTTCG / CTTTATTCTTGAGTTTGGTGT
SPRY domain-containing protein 19 GROS_g14260.t1 GCATTGATGGAAAGACGACAAC / GTTGCTGGTGGTTCTGATACT
SPRY domain-containing protein 19 GROS_g14126.t1 CGCGCCAAACAACAGTTAAT / GCATTTGTTCGGTCGCAAG
Pectase lyase 1 GROS_g07968.t1 GCTACTGGGTTCGGATACAA / GGCCAGATTGCGTGAAATAC
Glutathione peroxidase GROS_g02490.t1 TCTACGACTTTGAGGTGGAAAC / GAAACGGGTTGAAGTCCAGATA
Neprilisin GROS_g12349.t1 AATCACGCCGCCAAAGAA / CCAATGATGAGAGTGGTCGTAAA
Unknown GROS_g09749.t1 CGCCCATCCCATTAGTGTT / CAACGACAAATCATGTTCTCCTC
Unknown GROS_g10809.t1 AAATTCCGGTCGGCTCCT / TATTCCACGAACGGCTCCA
Polyubiquitin-B-like GROS_g11284.t1 GCGACTGATCTTTAATGGGAAAC / CATCCTCCACGAAGACAAAGA
Unknown GROS_g12023.t1 CGAATTGCCGGATGTTCTTG / CGTGTCAATTCGGTCGTAGAA
Unknown GROS_g13375.t1 CGAGATGGTGTGATCAAGAAGA / TGACTGCGAGTTCGATTGG
Unknown GROS_g13474.t1 CAGACAACACAGCACAACTTC / CTGAATCCCGGTCCTTGAAT
Unknown GROS_g13669.t1 TTACGACTCCGCAAGTGTTC / TTGACTGCGGCGATTTCA