Skip to main content

Table 2 List of primers used for Real-Time quantitative RT-PCR

From: Transcriptome analysis reveals plasticity in gene regulation due to environmental cues in Primula sikkimensis, a high altitude plant species

S. NoGene nameForward primer (5`-3`)Reverse primer (5`-3`)
1Photosystem II protein PsbRAGCTCCCACCTCAAGGAGATAGCAACTCTTCAGCCTCTGC
2Photosystem I reaction centre subunit VIAGGTGGAGGTTGCTGTGACTCTTCTCTGCGACCGTTAAGC
3Plant lipid transfer protein/seed storageCAACAGCTGAGAGAACCCATCGGCAGCTATGCCTTTCATCT
4Ferredoxin-type proteinAAGGAGCTGGTTGTCAAGGAATCTGCTCACACATCGCAAG
5Fructose-bisphosphate aldolase, class-ICCATGATGTGGTGGACGATAGGCTAGCCTGCGATGTCTAC
6Ubiquitin-conjugating enzyme, E2AGGCTTCCGTGCTACACAACTTAAGGCAGGTTGCTCCTTC
7Plant metallothionein, family 15GTTAGAACCTGGGTGGCATCGATCTTTGGCTCGACTTGCT
8Oxoglutarate/iron-dependent oxygenaseCCAGTCAAAGACTCGGAACCGAAGGAGTCACCGTCTCCAG
9Glutamine synthetase/guanido kinase, catalytic domainCCCACTTTAGAGCGAGAGACTGGTGAGATGACGGCGATGAC
10Urease accessory protein UreDCTCCAAGTTTCCGAGGATTGCCCTAAGCCAGCACTGTAGC
1126 S rRNACCCTGTGGTAACTTTTCTGGCTCGTTTGATTCTGATTTC