Skip to main content
Download PDF

Genome-wide identification of enhancers and transcription factors regulating the myogenic differentiation of bovine satellite cells

BMC Genomics volume 22, Article number: 901 (2021) Cite this article

Abstract

Background

Satellite cells are the myogenic precursor cells in adult skeletal muscle. The objective of this study was to identify enhancers and transcription factors that regulate gene expression during the differentiation of bovine satellite cells into myotubes.

Results

Chromatin immunoprecipitation followed by deep sequencing (ChIP-seq) was performed to identify genomic regions where lysine 27 of H3 histone is acetylated (H3K27ac), i.e., active enhancers, from bovine satellite cells before and during differentiation into myotubes. A total of 19,027 and 47,669 H3K27ac-marked enhancers were consistently identified from two biological replicates of before- and during-differentiation bovine satellite cells, respectively. Of these enhancers, 5882 were specific to before-differentiation, 35,723 to during-differentiation, and 13,199 common to before- and during-differentiation bovine satellite cells. Whereas most of the before- or during-differentiation-specific H3K27ac-marked enhancers were located distally to the transcription start site, the enhancers common to before- and during-differentiation were located both distally and proximally to the transcription start site. The three sets of H3K27ac-marked enhancers were associated with functionally different genes and enriched with different transcription factor binding sites. Specifically, many of the H3K27ac-marked enhancers specific to during-differentiation bovine satellite cells were associated with genes involved in muscle structure and development, and were enriched with binding sites for the MyoD, AP-1, KLF, TEAD, and MEF2 families of transcription factors. A positive role was validated for Fos and FosB, two AP-1 family transcription factors, in the differentiation of bovine satellite cells into myotubes by siRNA-mediated knockdown.

Conclusions

Tens of thousands of H3K27ac-marked active enhancers have been identified from bovine satellite cells before or during differentiation. These enhancers contain binding sites not only for transcription factors whose role in satellite cell differentiation is well known but also for transcription factors whose role in satellite cell differentiation is unknown. These enhancers and transcription factors are valuable resources for understanding the complex mechanism that mediates gene expression during satellite cell differentiation. Because satellite cell differentiation is a key step in skeletal muscle growth, the enhancers, the transcription factors, and their target genes identified in this study are also valuable resources for identifying and interpreting skeletal muscle trait-associated DNA variants in cattle.

Peer Review reports

Background

Skeletal muscle is the largest tissue in the body and plays an important role in physiology [1, 2]. Skeletal muscle from meat-producing animals is a major source of food for humans and animals. Adult skeletal muscle is composed of mostly muscle fibers [3]. A muscle fiber, also known as a myofiber, is a multinucleated muscle cell differentiated and fused from multiple mononuclear muscle cells called myoblasts. For most mammals, the total number of myofibers is determined prenatally [4]; thus, postnatal skeletal muscle growth results primarily from myofiber hypertrophy [4, 5]. Postnatal myofiber hypertrophy, however, requires additional nuclei [6, 7]. In postnatal animals, nuclei added to the existing myofibers are widely believed to come from satellite cells, which are mononuclear cells located near myofibers and are considered stem cells in adult skeletal muscle [8,9,10]. Satellite cells are normally quiescent but can be activated by muscle injury and nutritional and environmental changes [6, 7]. Once activated, satellite cells become and proliferate as myoblasts and then differentiate and fuse with each other to generate new myotubes, the developing myofibers, or with existing myofibers to increase muscle fiber size.

A set of four transcription factors called myogenic regulatory factors (MRFs) are known to play important roles in myogenesis, the formation of muscle fibers from myoblasts or satellite cells [11, 12]. These MRFs include myogenic differentiation 1 (MYOD1, also known as MyoD and MYF3), myogenic factor 5 (MYF5), myogenin (MYOG, also known as MYF4), and myogenic factor 6 (MYF6, also known as MRF4 and herculin). All four MRFs are specifically or preferentially expressed in skeletal muscle [12]. All four MRFs are basic helix-loop-helix (bHLH) domain-containing transcription factors and regulate gene transcription by binding to the E-box sequence, CANNTG, where N is A, G, C, or T [13]. MYF5 and MYOD1 determine the myogenic lineage of stem cells in a redundant manner [11, 12]. MYOG is essential for myoblast differentiation and fusion into myotubes [12, 14]. MYF6 was thought to play a similar role to MYOG in myoblast differentiation, but a more recent study indicated an unexpected negative role of MYF6 in postnatal skeletal muscle growth [15].

Clearly, differentiation and fusion of myoblasts or satellite cells into myotubes is a key step in the development and growth of skeletal muscle. The objective of this study was to further understand the regulation of gene expression during the differentiation of bovine satellite cells into myotubes. Cattle are agriculturally important animals, and a better understanding of gene regulation during satellite cell differentiation could lead to the development of novel strategies to improve growth efficiency and meat quality in cattle. Enhancers are DNA sequences that enhance the transcription of associated genes when bound by sequence-specific transcription factors. Active enhancers are genomic regions that are bound by active transcription factors and that actively regulate gene transcription. Genomic regions containing active enhancers are found to be uniquely marked with H3K27ac, where lysine 27 of histone 3 protein is acetylated [16, 17]. We began this study by identifying genomic regions with H3K27ac modification in bovine satellite cells before and during induced differentiation and fusion into myotubes through chromatin immunoprecipitation coupled with deep sequencing (ChIP-seq). To our knowledge, such an approach had not been taken to study the transcriptional mechanisms that control gene expression during the myogenic differentiation of bovine satellite cells or satellite cells from any species.

Results

H3K27ac-marked enhancers in bovine satellite cells before and during differentiation

Four ChIP-seq libraries and two Input libraries constructed from bovine satellite cells immediately before and 2 days after induction of differentiation passed the quality control, and deep sequencing generated 23 to 40 million sequencing reads from these libraries (Table 1). Between 75 and 92% of these reads were uniquely mapped to the bovine genome, generating approximately 20 to 36 million uniquely mapped reads per library (Table 1).

Table 1 Mapping summary of ChIP-seq libraries
Full size table

Analyzing the uniquely mapped reads from each ChIP-seq library against those from the corresponding Input library using the MACS peak calling program identified more than 30,000 and 50,000 H3K27ac-marked genomic regions, i.e., active enhancers, from before-differentiation (BD) and during-differentiation (DD) bovine satellite cells, respectively. A phantompeakqualtools analysis indicated that the four ChIP-seq libraries had normalized strand cross-correlation (NSC) values between 1.16 and 1.18 and relative strand cross-correlation (RSC) values between 0.98 and 1.06 (Additional File 1), indicating strong enrichment of reads in peaks [18].

A Pearson correlation analysis revealed that the H3K27ac-marked enhancer regions identified from two biological replicates, which corresponded to BD or DD satellite cells originally isolated from two different cattle, were highly correlated (Fig. 1A). A total of 19,027 H3K27ac-marked enhancers were consistently identified from two biological replicates of BD bovine satellite cells, while 47,669 H3K27ac-marked enhancers were consistently identified from two biological replicates of DD bovine satellite cells (Fig. 1B). A total of 5882 H3K27ac-marked enhancers were found to be specific to BD bovine satellite cells, 35,723 H3K27ac-marked enhancers specific to DD bovine satellite cells, and 13,199 H3K27ac-marked enhancers common to both BD and DD bovine satellite cells (Fig. 1C, Additional Files 2, 3, 4).

Fig. 1
figure 1

Identification of H3K27ac-marked enhancers in before-differentiation (BD) and during-differentiation (DD) bovine satellite cells. A Pearson correlation analyses of ChIP-seq and Input libraries from two biological replicates. B Numbers of H3K27ac-marked enhancers consistently identified from two experiments. C Numbers of H3K27ac-marked enhancers specific to BD or DD bovine satellite cells or common to both BD and DD bovine satellite cells

Full size image

Examples of H3K27ac-marked enhancers identified from BD and DD bovine satellite cells are shown in Table 2 and Fig. 2A. These enhancers were associated with the MYOG gene, which, as mentioned above, is a transcription factor essential for myoblast differentiation, and myosin heavy chain 3 (MYH3) gene, which, as indicated by its name, encodes a skeletal muscle-specific myosin heavy chain protein. As shown in Table 2 and Fig. 2A, MYOG-associated enhancers were marked with H3K27ac only in DD bovine satellite cells; MYH3-associated enhancers were marked with H3K27ac in both BD and DD bovine satellite cells but more MYH3-associated enhancers were marked with H3K27ac in DD than in BD bovine satellite cells. As shown by Fig. 2B, the increased H3K27ac modification to MYOG- and MYH3-associated genomic regions in DD satellite cells was accompanied by increased expression of both genes in these cells.

Table 2 Examples of H3K27ac-marked enhancers and associated genes in bovine satellite cells
Full size table
Fig. 2
figure 2

Examples of H3K27ac-marked enhancers in bovine satellite cells. A IGV tracks showing H3K27ac-marked enhancers associated with the myogenin (MYOG) and myosin heavy chain 3 (MYH3) genes in before-differentiation (BD) and during-differentiation (DD) bovine satellite cells. B Relative expression levels of MYOG and MHY3 mRNAs in BD and DD bovine satellite cells. *P < 0.05 (n = 4). Gene expression data was retrieved from a previous study [19]

Full size image

Genomic distribution of H3K27ac-marked enhancers in bovine satellite cells

H3K27ac-marked enhancers specific to BD or DD bovine satellite cells had different genomic distribution from the H3K27ac-marked enhancers common to both BD and DD bovine satellite cells. Whereas nearly 90% of H3K27ac-marked enhancers specific to BD or DD bovine satellite cells were located in the distal intergenic regions and introns, this percentage was only 60% for H3K27ac-marked enhancers common to BD and DD bovine satellite cells (Fig. 3A). Whereas approximately 6 and 17% of H3K27ac-marked enhancers specific to BD and DD bovine satellite cells, respectively, were located in the promoter regions, this percentage was almost 50% for H3K27ac-marked enhancers common to BD and DD bovine satellite cells (Fig. 3A). Whereas H3K27ac-marked enhancers specific to BD or DD bovine satellite cells were concentrated at 100,000 bp from the transcription start site (TSS), those common to BD and DD bovine satellite cells were concentrated at both 100 bp and 100,000 bp from the TSS (Fig. 3B and C).

Fig. 3
figure 3

Genomic distribution and location of H3K27ac-marked enhancers in bovine satellite cells. A Percentages of H3K27ac-marked enhancers located in various genomic regions. BD, before differentiation; DD, during differentiation; UTR, untranslated region. B Distances of H3K27ac-marked enhancers from the transcription start sites (TSS). (C) Frequency of proximal H3K27ac-marked enhancers by distance from the TSS

Full size image

Expression levels of genes associated with and without H3K27ac modification in bovine satellite cells

We compared the expression levels of genes associated with H3K27ac modification with those without H3K27ac modification in bovine satellite cells. The transcriptome data of BD and DD bovine satellite cells were generated in a previous study [19]. As shown in Fig. 4A, in both BD and DD bovine satellite cells, genes associated with H3K27ac modification were expressed at levels nearly three-fold those of genes without H3K27ac modification. Overall, 5882 H3K27ac-marked enhancer regions specific to BD bovine satellite cells were associated with 3064 protein-coding genes; 35,723 H3K27ac-marked enhancers specific to AD bovine satellite cells were associated with 7649 protein-coding genes; 13,199 H3K27ac-marked enhancers common to BD and DD bovine satellite cells were associated with 6337 protein-coding genes. Obviously, many genes were associated with more than one H3K27ac-marked enhancers in bovine satellite cells. However, the numbers of H3K27ac-marked enhancers were not correlated with the expression levels of associated genes, regardless of the differentiation stage of the cells (Fig. 4B).

Fig. 4
figure 4

Association of H3K27ac modification with gene expression level in bovine satellite cells. A Genes with H3K27ac (+H3K27ac) modification were expressed at greater levels than genes without H3K27ac (−H3K27ac) modification in both before-differentiation (BD) and during-differentiation (DD) bovine satellite cells. *P < 0.05. B Pearson correlation analyses revealed that the numbers of H3K27ac-marked enhancers were not correlated with the expression levels of associated genes in either BD or DD bovine satellite cells

Full size image

Functional terms enriched in genes associated with H3K27ac modification in bovine satellite cells

We performed gene ontology (GO) enrichment analyses on genes associated with H3K27ac modification in bovine satellite cells. Top biological processes and cellular components enriched in genes associated with H3K27ac modification specifically in DD bovine satellite cells were related to skeletal muscle structure, development, and adaptation, and cell cycle arrest (Tables 3 and 4). It is interesting to note that many genes involved in melanosome and phagocytic vesicle were also associated with H3K27ac modification in DD bovine satellite cells (Table 4). Most of the top molecular functions enriched in genes associated with H3K27ac modification specifically in DD bovine satellite cells were related to growth factor binding and serine and threonine kinase signaling (Table 5). Top biological processes, cellular components, and molecular functions enriched in genes associated with H3K27ac modification in BD bovine satellite cells included pentose metabolic process (Additional File 5), postsynaptic membrane (Additional File 6), and transmembrane receptor protein tyrosine kinase activity (Additional File 7), respectively, which were different from those enriched in genes associated with H3K27ac modification in DD satellite cells (Tables 3, 4 and 5). Top biological processes, cellular components, and molecular functions enriched in genes associated with H3K27ac modification in both BD and DD bovine satellite cells included those related to proteasome and autophagosome (Additional Files 8, 9 and 10).

Table 3 Top 10 GO biological processes enriched in genes associated with H3K27ac-marked enhancers in during-differentiation bovine satellite cells
Full size table
Table 4 Top 10 GO cellular components enriched in genes associated with H3K27ac-marked enhancers in during-differentiation bovine satellite cells
Full size table
Table 5 Top 10 GO molecular functions enriched in genes associated with H3K27ac-marked enhancers in during-differentiation bovine satellite cells
Full size table

Transcription factor binding sites enriched in H3K27ac-marked enhancers in bovine satellite cells

Motif enrichment analyses of 35,373 enhancer regions marked with H3K27ac specifically in DD bovine satellite cells indicated enrichment of binding sites for many transcription factors (Additional File 11). The top 30 motifs enriched in these enhancers included binding sites for the bHLH transcription factors MYF5, MYOG, TFAP4 (also known as AP4), MYOD1, TCF12, TCF21, ATOH1, and ASCL2, the basic leucine zipper (bZIP) transcription factors JUN, FOS, FOSB, FOSL2 (also known as FRA2), FOSL1 (also known as FRA1), BATF, JUNB, BACH2, and ATF3, the Krüppel-like family (KLF) transcription factors KLF1, KLF5, and KLF14 (Table 6). Motif enrichment analyses of 5882 enhancer regions marked with H3K27ac specifically in BD bovine satellite cells and 13,199 enhancers marked with H3K27ac in both BD and DD bovine satellite cells revealed enrichment of different sets of transcription factor binding sites (Additional Files 12 and 13). Top motifs enriched in enhancers marked with H3K27ac specifically in BD bovine satellite cells included binding sites for transcription factors ZIC3, TCP16, ASCL2, TFAP2C (also known as AP-2 gamma), ZIC2, MAX, and MYC (Additional File 12). Top motifs enriched in enhancers marked with H3K27ac in both BD and DD bovine satellite cells included many members of the ETS family transcription factors such as ELK1, ELF1, ELK4, GABPA, ETV4, FLI1, ETV1, and ELF4 (Additional File 13).

Table 6 Top 30 motifs enriched in H3K27ac-marked enhancers in during-differentiation bovine satellite cells
Full size table

Validation of the role of FOS and FOSB in bovine satellite cell differentiation

The motif enrichment analyses of H3K27ac-marked enhancers in BD and DD bovine satellite cells indicated that gene transcription during bovine satellite cell differentiation is controlled by transcription factors besides the widely known four MRFs. These additional transcription factors include the AP-1 family of transcription factors. We tested the role of the AP-1 transcription factor family members FOS and FOSB in bovine satellite cell differentiation. In this experiment, we transfected bovine satellite cells with siRNA targeting bovine FOS or FOSB mRNA, induced the satellite cells to differentiate and fuse into myotubes, and measured the myogenic differentiation extent of the cells by quantifying the expression of markers of differentiated myoblasts, including MYH2, MYH3, MYOG, and CKM (creatine kinase, M-type). As shown in Fig. 5A and B, in bovine satellite cells transfected with the negative control siRNA, the mRNA expression levels of these markers were significantly increased on day 3 of differentiation compared to their expression levels on the day before induction of differentiation. However, the mRNA expression levels of these markers in bovine satellite cells transfected with siRNA targeting FOS or FOSB mRNA were markedly lower than in cells transfected with the negative control siRNA. Morphologically, satellite cells transfected with siRNA targeting FOS or FOSB mRNA formed fewer and smaller myotubes than those transfected with the negative control siRNA (Fig. 5C). These data support a positive role for FOS and FOSB in bovine satellite cell differentiation and fusion into myotubes.

Fig. 5
figure 5

Effect of siRNA-mediated knockdown of FOS or FOSB mRNA on bovine satellite cell differentiation. Bovine satellite cells were transfected with siRNA targeting FOS or FOSB mRNA or negative control (NC) siRNA and then induced to differentiate and fuse into myotubes for 3 days. A Expression levels of 4 marker genes of differentiated myoblasts. D0 and D3 mean the day before and day 3 after induction of differentiation, respectively. Bars not sharing the same letter label are different (P < 0.05, n = 6). B Representative images of bovine satellite cells transfected with FOS, FOSB, or negative control siRNA on day 3 of differentiation

Full size image

Discussion

Histone modification affects gene transcription by altering the accessibility of chromatin and the recruitment of transcription factors and cofactors to chromatin [20]. Large-scale mapping of histone modification has revealed that different types of enhancers are associated with different histone modifications. Active enhancers are associated with H3K27ac and histone 3 lysine 4 monomethylation (H3K4me1) modifications; primed or poised enhancers are marked with H3K4me1 but not H3K27ac; and silenced or repressed enhancers are often associated with H3K27me3 modification [21,22,23,24]. Based on these associations, ChIP-seq has been widely used to identify enhancers and other types of regulatory DNA regions in whole genomes [25,26,27,28,29,30,31]. In this study, we have identified 19,027 and 47,669 H3K27ac-marked enhancers in bovine satellite cells before and during differentiation, respectively. Identification of these enhances provides a valuable resource for understanding the mechanism that regulates gene expression during satellite cell differentiation, a key step in skeletal muscle development and growth.

Compared to the consistent identification of 47,669 H3K27ac-marked active enhancers from two biological replicates of during-differentiation bovine satellite cells, only 19,027 H3K27ac-marked active enhancers were repeatedly identified from two samples of before-differentiation bovine satellite cells. This difference suggests much more active transcription factor binding to the genome, much more active recruitment of histone acetylases, and hence much more active H3K27ac modification in bovine satellite cells during differentiation than before differentiation. There is a possibility that this difference was caused by biological variation, as indicated by the large difference in the numbers of H3K27-marked enhancers identified from two samples of before-differentiation satellite cells. In our research on satellite cells, we have noticed satellite cells from different animals differ in differentiation potential in culture, and this difference suggests animal-to-animal variation in gene expression and histone modification in satellite cells.

Enhancers can be located upstream or downstream of TSS, in introns or exons, and near or distantly from the promoters [32,33,34]. Some enhancers can be located in intergenic regions several hundred kilobases away from TSS and control gene transcription by forming DNA loops with the promoters [35,36,37]. Genomic distribution analyses showed that H3K27ac-marked enhancers in bovine satellite cells have similar genomic distribution to enhancers in other types of cells or species [32,33,34]. However, the genomic location of H3K27ac-marked enhancers in bovine satellite cells varies with the differentiation stage of these cells. Whereas most of the differentiation stage-dependent H3K27ac-marked enhancers in bovine satellite cells were located in the distal intergenic regions, most of the differentiation stage-independent H3K27ac-marked enhancers in bovine satellite cells were located in the promoter regions. This study also showed that H3K27ac-marked enhancers specific to during-differentiation bovine satellite cells were associated with genes involved in muscle organization, adaptation, and development while H3K27ac-marked enhancers common to both before- and during-differentiation satellite cells were associated with genes involved in basic cellular functions and processes. These results suggest that distal enhancers are preferentially activated to increase the expression of genes determining the differentiation stage of satellite cells, whereas proximal enhancers or promoters are preferentially activated to increase the expression of genes maintaining the basic cellular function of satellite cells. This differentiation stage-dependent activation of distal and proximal enhancers in bovine satellite cells is apparently consistent with earlier findings that distal enhancers mediate the expression of cell type- or developmental stage-specific genes while core promoters and proximal enhancers are responsible for the expression of housekeeping genes [38, 39].

This study showed that genes associated with H3K27ac modification were expressed at greater levels than those without H3K27ac modification in bovine satellite cells, regardless of the differentiation stage of the cells. This result supports H3K27ac as a histone marker for transcriptional activation [16]. This study also showed that many genes were associated with multiple H3K27ac-marked enhancers, but that the numbers of H3K27ac-marked enhancers were not correlated with the expression levels of associated genes in bovine satellite cells. These results suggest that multiple H3K27ac-marked enhancers do not function in an additive manner to increase gene expression or that multiple H3K27ac-marked enhancers are functionally redundant in bovine satellite cells. Indeed, recent studies using the CRISPR-Cas9 approach demonstrate that not every enhancer is functionally important and that most enhancers provide only a supportive or backup role in regulating gene expression [40,41,42].

H3K27ac modification at enhancers results from transcription factor binding and subsequent recruitment of histone acetyltransferases such as p300 and CBP [43, 44]. In this study we have identified many transcription factors that may bind to H3K27ac-marked enhancers in bovine satellite cells before or during differentiation. Among the transcription factors that are predicted to bind to H3K27ac-marked enhancers in during-differentiation bovine satellite cells are MYOG and MYOD1, the MEF2 family transcription factors, the KLF family transcription factors, and the TEAD family transcription factors. Both MYOG and MYOD1 are known as the central transcriptional regulators of myoblast differentiation, and they regulate the expression of muscle-specific genes by binding to the motif called E-box [45]. The MEF2 family transcription factors MEF2A, MEF2C and MEF2D [45, 46], the KLF family transcription factors KLF3 and KLF5 [47, 48], and the TEAD family transcription factors TEAD2 and TEAD4 [49,50,51] have also been shown to play a positive role in myoblast differentiation. Identification of the binding sites for MYOG, MYOD1, MEF2, KLF, and TEAD transcription factors among the top motifs enriched in H3K27ac-marked enhancers in during-differentiation bovine satellite cells validates the quality of active enhancers identified in this study.

This study shows that many other transcription factors regulate gene expression during satellite cell differentiation, and these other transcription factors include the AP-1 family of transcription factors (e.g., FOS). Enrichment of binding sites for the AP-1 family of transcription factors in active enhancers in during-differentiation bovine satellite cells is intriguing because the member of the AP-1 family of transcription factors JUN is known to antagonize the stimulatory effect of MYOD1 on myoblast differentiation [52]. However, overexpression of JUNB, a member of the AP-1 family of transcription factors closely related to JUN, increased hypertrophy and expression of the muscle-specific gene MYH4 in C2C12 myoblasts [53]. We have also validated a positive role of two members of the AP-1 family of transcription factors, namely FOS and FOSB, in driving bovine satellite cell differentiation in this study. Therefore, different members of the AP-1 family of transcription factors might have different effects on gene expression during myoblast or satellite cell differentiation.

Conclusions

In summary, we have identified tens of thousands of genomic regions associated with H3K27ac modification, i.e., active enhancers, in before- or during-differentiation bovine satellite cells. These enhancer regions contain binding sites for many transcription factors, including MYOG and MYOD1, whose role in myoblast or satellite cell differentiation is widely known, and the AP-1 transcription factors, AP-4, and many others, whose roles in myoblast or satellite cell differentiation are less known or unknown. These enhancers and transcription factors should be valuable for elucidating the mechanisms that mediate gene transcription during myoblast or satellite cell differentiation. Because myoblast or satellite cell differentiation is a key step of skeletal muscle development and growth, the enhancers, the transcription factors, and the genes targeted by these enhancers and transcription factors should be also valuable for identifying and interpreting skeletal muscle trait-associated DNA sequences and variants in cattle, which are agriculturally important animals.

Methods

Isolation and culture of bovine satellite cells

Skeletal muscle was collected from Angus-crossbred steers slaughtered at the Virginia Tech Meat Center. Satellite cells was isolated through pronase digestion and differential centrifugation as described before [54, 55]. Satellite cells were cultured in growth medium for about a week before being induced to differentiate and fuse into myotubes. Differentiation of bovine satellite cells into myotubes was induced by replacing growth medium with differentiation medium. Growth medium consisted of Dulbecco’s Modified Eagle Medium (DMEM), 10% fetal bovine serum (FBS) (R&D Systems, Minneapolis, MN, USA), 2 mM L-glutamine, and 1% Antibiotic-Antimycotic (100×) (ABAM). Differentiation medium consisted of DMEM, 2% horse serum (R&D Systems), 2 mM L-glutamine, and 1% ABAM. All cell culture was performed at 37 °C in a humidified, 5% CO2 atmosphere. All cell culture reagents were purchased from ThermoFisher Scientific (Waltham, MA, USA) unless otherwise indicated.

ChIP assay

Satellite cells from two steers immediately before and 2 days after induction of differentiation were cross-linked in 1% formaldehyde for 10 min and then lysed in lysis buffer from the ChIP-IT kit (Active Motif, Carlsbad, CA, USA). Cell nuclei were suspended in ChIP buffer from the ChIP-IT kit and then sheared on ice by 10 pulses of 20-s sonication using a sonic dismembrator Model 100 at setting 3 (ThermoFisher Scientific) to generate chromatin fragments of 200 to 1000 bp. To identify the genomic regions associated with H3K27ac modification, chromatin fragments were incubated with an anti-histone H3K27ac antibody (ab4729, abcam, Cambridge, MA, USA) at 4 °C overnight with gentle rocking. The H3K27ac antibody-chromatin complexes were separated from unbound chromatin fragments using protein G-Dynal beads (ThermoFisher Scientific). Chromatin fragments immunoprecipitated by the H3K27ac antibody and those before immunoprecipitation (i.e., input chromatin) were reverse cross-linked by incubating them at 65 °C for 4 h. DNA was extracted and purified using spin columns from the ChIP-IT kit.

ChIP-seq library construction and sequencing

ChIP-seq libraries were prepared using the NEBNext ChIP-Seq Library Prep Reagent Set for Illumina (New England BioLabs, Ipswich, MA, USA), according to the supplier’s instructions. Briefly, ChIP DNA was end repaired using T4 DNA polymerase, Klenow DNA polymerase, and T4 polynucleotide kinase. End-repaired DNA was then added with 3′ dA overhangs using exonuclease minus Klenow DNA polymerase and dATP. The dA-tailed DNA fragments were ligated to the sequencing adaptor. DNA fragments of approximately 300 bp were selected from the adaptor-ligated DNA using AMPure XP Beads. The size-selected DNA fragments were amplified in 12 cycles of PCR using an index primer and a universal PCR primer. Two ChIP-seq libraries were prepared from DNA immunoprecipitated from before- or during-differentiation bovine satellite cells originally isolated from two different cattle. Two Input-seq libraries were prepared from input DNA pooled equally from before- and during-differentiation bovine satellite cells. Two biological replicates were used for ChIP-seq according to the ChIP-seq guidelines and practices proposed by the ENCODE and modENCODE consortia [18]. Each library was assessed for quality on a Bioanalyzer before being single-end sequenced on an Illumina Hiseq 2500 at the Genomics Sequencing Center at Virginia Tech.

ChIP-seq data analyses

Sequences from ChIP-seq libraries were first trimmed to remove the adapters using Trimmomatic [56]. The trimmed reads were then mapped to the bovine genome assembly (ARS-UCD 1.2 BosTau 9) using Hisat2 (2.2.0) [57]. The aligned reads were sorted and merged using SAMtools (1.9) [58]. Peak calling of the aligned reads was made using MACS3 (3.0.0a5) [59], where a H3K27ac-ChIP-seq library was compared to an Input-seq library (i.e., control) made from the same satellite cells, and where the q-value threshold was set as 0.05. Quality of peak enrichment in ChIP-seq reads was assessed by Phantompeakqualtools [60]. ChIP-seq peaks were visualized in the IGV browser (2.8.2) [61]. ChIP-seq peaks were annotated using ChIPseeker (1.22.1) [62]. Motif enrichment analyses were performed using HOMER (4.11.1) [63]. Gene ontology (GO) enrichment analysis was performed using the PANTHER Classification System [64,65,66].

Small interfering RNA (siRNA)-mediated gene knockdown

Bovine satellite cells in 12-well plates were transfected with 30 nM of siRNA targeting bovine FOS or FOSB mRNA using 6 μL of Lipofectamine RNAiMAX Reagent according to the supplier’s instructions (ThermoFisher Scientific). A universal negative control siRNA (MISSION siRNA Universal Negative Control #1, Millipore Sigma, Burlington, MA, USA) was transfected as a negative control. The sense and antisense siRNA sequences targeting bovine FOS and FOSB mRNAs were CAGAAGAGAUGUCUGUGGCUUCUCU and AGAGAAGCCACAGACAUCUCUUCUG, and GACAUGCCAGGAACCAGUUACUCCA and UGGAGUAACUGGUUCCUGGCAUGUC, respectively. These siRNAs were confirmed to have at least 70% knockdown efficiency in pilot experiments. Following transfection, bovine satellite cells were cultured in differentiation medium for 48 h as descried above. The differentiation degree of satellite cells was assessed by quantifying mRNA expression of markers of differentiated myoblasts, including CKM, MYH2, MYH3, and MYOG, as previously described [19].

RNA extraction and reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was extracted from bovine satellite cells using the Direct-zol RNA Miniprep Kit (Zymo Research, Irvine, CA, USA). Reverse transcription of total RNA into cDNA was performed using ImProm-II reverse transcriptase and random primers according to the manufacture’s instruction (Promega, Madison, WI, USA). Quantitative PCR was performed using the SYBR Green chemistry as described previously [19]. The relative abundance of target mRNAs was calculated using the 2-ΔΔCt method [67]. The Ct values for target mRNAs were normalized to the Ct values for HMBS, which was chosen as a reference gene because it was stably expressed in different conditions [68].

Statistical analysis

Gene expression data were analyzed by ANOVA. Two means were compared by t-test, and multiple means were compared by the Tukey test. All data are expressed as mean ± standard error.

Availability of data and materials

The datasets generated and/or analyzed during this study are available as additional files 1–14. The sequencing data from this study has been deposited in the NCBI GEO database (https://www.ncbi.nlm.nih.gov/geo/) under accession number GSE179821.

Abbreviations

ABAM:

Antibiotic-antimycotic

BD:

Before differentiation

ChIP:

Chromatin immunoprecipitation assay

ChIP-seq:

Chromatin immunoprecipitation coupled with sequencing

DD:

During differentiation

DMEM:

Dulbecco’s Modified Eagle Medium

FBS:

Fetal bovine serum

GO:

Gene ontology

H3K27ac:

Histone 3 lysine 27 acetylation

H3K4me1:

Histone 3 lysine 4 monomethylation

H3K4me3:

Histone 3 lysine 4 trimethylation

MRF:

Myogenic regulatory factor

RT-qPCR:

Reverse transcription-quantitative PCR

References

  1. Yin H, Price F, Rudnicki MA. Satellite cells and the muscle stem cell niche. Physiol Rev. 2013;93(1):23–67.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  2. Hoppeler H, Fluck M. Plasticity of skeletal muscle mitochondria: structure and function. Med Sci Sport Exer. 2003;35(1):95–104.

    Article  CAS  Google Scholar 

  3. Astruc T: Carcass Composition, Muscle Structure, and Contraction. In: Encyclopedia of Meat Sciences (Second Edition). Edited by Dikeman M, Devine C: Academic Press; 2014: 148–166.

  4. Allen RE, Merkel RA, Young RB. Cellular aspects of muscle growth: myogenic cell proliferation. J Anim Sci. 1979;49(1):115–27.

    Article  CAS  PubMed  Google Scholar 

  5. Oksbjerg N, Gondret F, Vestergaard M. Basic principles of muscle development and growth in meat-producing mammals as affected by the insulin-like growth factor (IGF) system. Domest Anim Endocrinol. 2004;27(3):219–40.

    Article  CAS  PubMed  Google Scholar 

  6. Bi P, Kuang S. Meat science and muscle biology symposium: stem cell niche and postnatal muscle growth. J Anim Sci. 2012;90(3):924–35.

    Article  CAS  PubMed  Google Scholar 

  7. Dhawan J, Rando TA. Stem cells in postnatal myogenesis: molecular mechanisms of satellite cell quiescence, activation and replenishment. Trends Cell Biol. 2005;15(12):666–73.

    Article  CAS  PubMed  Google Scholar 

  8. Mauro A. Satellite cell of skeletal muscle fibers. J Biophys Biochem Cytol. 1961;9:493–5.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  9. Gros J, Manceau M, Thome V, Marcelle C. A common somitic origin for embryonic muscle progenitors and satellite cells. Nature. 2005;435(7044):954–8.

    Article  CAS  PubMed  Google Scholar 

  10. Cornelison DD, Wold BJ. Single-cell analysis of regulatory gene expression in quiescent and activated mouse skeletal muscle satellite cells. Dev Biol. 1997;191(2):270–83.

    Article  CAS  PubMed  Google Scholar 

  11. Bentzinger CF, Wang YX, von Maltzahn J, Rudnicki MA. The emerging biology of muscle stem cells: implications for cell-based therapies. BioEssays. 2013;35(3):231–41.

    Article  CAS  PubMed  Google Scholar 

  12. Pownall ME, Gustafsson MK, Emerson CP Jr. Myogenic regulatory factors and the specification of muscle progenitors in vertebrate embryos. Annu Rev Cell Dev Biol. 2002;18:747–83.

    Article  CAS  PubMed  Google Scholar 

  13. Braun T, Arnold HH. The four human muscle regulatory helix-loop-helix proteins Myf3-Myf6 exhibit similar hetero-dimerization and DNA binding properties. Nucleic Acids Res. 1991;19(20):5645–51.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  14. Bentzinger CF, Wang YX, Rudnicki MA. Building muscle: molecular regulation of myogenesis. Cold Spring Harb Perspect Biol. 2012;4:2.

    Article  Google Scholar 

  15. Moretti I, Ciciliot S, Dyar KA, Abraham R, Murgia M, Agatea L, et al. MRF4 negatively regulates adult skeletal muscle growth by repressing MEF2 activity. Nat Commun. 2016;7:12397.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  16. Creyghton MP, Cheng AW, Welstead GG, Kooistra T, Carey BW, Steine EJ, et al. Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proc Natl Acad Sci U S A. 2010;107(50):21931–6.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  17. Andersson R, Gebhard C, Miguel-Escalada I, Hoof I, Bornholdt J, Boyd M, et al. An atlas of active enhancers across human cell types and tissues. Nature. 2014;507(7493):455–61.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  18. Landt SG, Marinov GK, Kundaje A, Kheradpour P, Pauli F, Batzoglou S, et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 2012;22(9):1813–31.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  19. Leng X, Ji X, Hou Y, Settlage R, Jiang H. Roles of the proteasome and inhibitor of DNA binding 1 protein in myoblast differentiation. FASEB J. 2019;33(6):7403–16.

    Article  CAS  PubMed  Google Scholar 

  20. Kouzarides T. Chromatin modifications and their function. Cell. 2007;128(4):693–705.

    Article  CAS  PubMed  Google Scholar 

  21. Spicuglia S, Vanhille L. Chromatin signatures of active enhancers. Nucleus. 2012;3(2):126–31.

    Article  PubMed  PubMed Central  Google Scholar 

  22. Shlyueva D, Stampfel G, Stark A. Transcriptional enhancers: from properties to genome-wide predictions. Nat Rev Genet. 2014;15(4):272–86.

    Article  CAS  PubMed  Google Scholar 

  23. Plank JL, Dean A. Enhancer function: mechanistic and genome-wide insights come together. Mol Cell. 2014;55(1):5–14.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  24. Calo E, Wysocka J. Modification of enhancer chromatin: what, how, and why? Mol Cell. 2013;49(5):825–37.

    Article  CAS  PubMed  Google Scholar 

  25. Consortium EP. An integrated encyclopedia of DNA elements in the human genome. Nature. 2012;489(7414):57–74.

    Article  Google Scholar 

  26. Rada-Iglesias A, Bajpai R, Swigut T, Brugmann SA, Flynn RA, Wysocka J. A unique chromatin signature uncovers early developmental enhancers in humans. Nature. 2011;470(7333):279.

    Article  CAS  PubMed  Google Scholar 

  27. Bonn S, Zinzen RP, Girardot C, Gustafson EH, Perez-Gonzalez A, Delhomme N, et al. Tissue-specific analysis of chromatin state identifies temporal signatures of enhancer activity during embryonic development. Nat Genet. 2012;44(2):148–56.

    Article  CAS  PubMed  Google Scholar 

  28. Wamstad JA, Alexander JM, Truty RM, Shrikumar A, Li F, Eilertson KE, et al. Dynamic and coordinated epigenetic regulation of developmental transitions in the cardiac lineage. Cell. 2012;151(1):206–20.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  29. Shen Y, Yue F, McCleary DF, Ye Z, Edsall L, Kuan S, et al. A map of the cis-regulatory sequences in the mouse genome. Nature. 2012;488(7409):116–20.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. Kharchenko PV, Alekseyenko AA, Schwartz YB, Minoda A, Riddle NC, Ernst J, et al. Comprehensive analysis of the chromatin landscape in Drosophila melanogaster. Nature. 2011;471(7339):480–5.

    Article  CAS  PubMed  Google Scholar 

  31. Ziller MJ, Edri R, Yaffe Y, Donaghey J, Pop R, Mallard W, et al. Dissecting neural differentiation regulatory networks through epigenetic footprinting. Nature. 2015;518(7539):355–9.

    Article  CAS  PubMed  Google Scholar 

  32. Atchison ML. Enhancers: mechanisms of action and cell specificity. Annu Rev Cell Biol. 1988;4:127–53.

    Article  CAS  PubMed  Google Scholar 

  33. Blackwood EM, Kadonaga JT. Going the distance: a current view of enhancer action. Science. 1998;281(5373):60–3.

    Article  CAS  PubMed  Google Scholar 

  34. Maston GA, Evans SK, Green MR. Transcriptional regulatory elements in the human genome. Annu Rev Genomics Hum Genet. 2006;7:29–59.

    Article  CAS  PubMed  Google Scholar 

  35. Chepelev I, Wei G, Wangsa D, Tang Q, Zhao K. Characterization of genome-wide enhancer-promoter interactions reveals co-expression of interacting genes and modes of higher order chromatin organization. Cell Res. 2012;22(3):490–503.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Lettice LA, Heaney SJ, Purdie LA, Li L, de Beer P, Oostra BA, et al. A long-range Shh enhancer regulates expression in the developing limb and fin and is associated with preaxial polydactyly. Hum Mol Genet. 2003;12(14):1725–35.

    Article  CAS  PubMed  Google Scholar 

  37. Dean A. On a chromosome far, far away: LCRs and gene expression. Trends Genet. 2006;22(1):38–45.

    Article  CAS  PubMed  Google Scholar 

  38. Levine M, Cattoglio C, Tjian R. Looping back to leap forward: transcription enters a new era. Cell. 2014;157(1):13–25.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  39. Zabidi MA, Arnold CD, Schernhuber K, Pagani M, Rath M, Frank O, et al. Enhancer-core-promoter specificity separates developmental and housekeeping gene regulation. Nature. 2015;518(7540):556–9.

    Article  CAS  PubMed  Google Scholar 

  40. Carleton JB, Berrett KC, Gertz J. Multiplex enhancer interference reveals collaborative control of Gene regulation by estrogen receptor alpha-bound enhancers. Cell Syst. 2017;5(4):333–44 e335.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  41. Fulco CP, Munschauer M, Anyoha R, Munson G, Grossman SR, Perez EM, et al. Systematic mapping of functional enhancer-promoter connections with CRISPR interference. Science. 2016;354(6313):769–73.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  42. Osterwalder M, Barozzi I, Tissieres V, Fukuda-Yuzawa Y, Mannion BJ, Afzal SY, et al. Enhancer redundancy provides phenotypic robustness in mammalian development. Nature. 2018;554(7691):239–43.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  43. Raisner R, Kharbanda S, Jin L, Jeng E, Chan E, Merchant M, et al. Enhancer activity requires CBP/P300 Bromodomain-dependent histone H3K27 acetylation. Cell Rep. 2018;24(7):1722–9.

    Article  CAS  PubMed  Google Scholar 

  44. Weinert BT, Narita T, Satpathy S, Srinivasan B, Hansen BK, Scholz C, et al. Time-resolved analysis reveals rapid dynamics and broad scope of the CBP/p300 Acetylome. Cell. 2018;174(1):231–44 e212.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  45. Braun T, Gautel M. Transcriptional mechanisms regulating skeletal muscle differentiation, growth and homeostasis. Nat Rev Mol Cell Biol. 2011;12(6):349–61.

    Article  CAS  PubMed  Google Scholar 

  46. Molkentin JD, Black BL, Martin JF, Olson EN. Cooperative activation of muscle gene expression by MEF2 and myogenic bHLH proteins. Cell. 1995;83(7):1125–36.

    Article  CAS  PubMed  Google Scholar 

  47. Hayashi S, Manabe I, Suzuki Y, Relaix F, Oishi Y. Klf5 regulates muscle differentiation by directly targeting muscle-specific genes in cooperation with MyoD in mice. Elife. 2016;5.

  48. Himeda CL, Ranish JA, Pearson RC, Crossley M, Hauschka SD. KLF3 regulates muscle-specific gene expression and synergizes with serum response factor on KLF binding sites. Mol Cell Biol. 2010;30(14):3430–43.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  49. Figeac N, Mohamed AD, Sun C, Schonfelder M, Matallanas D, Garcia-Munoz A, et al. VGLL3 operates via TEAD1, TEAD3 and TEAD4 to influence myogenesis in skeletal muscle. J Cell Sci. 2019;132:13.

    Google Scholar 

  50. Joshi S, Davidson G, Le Gras S, Watanabe S, Braun T, Mengus G, et al. TEAD transcription factors are required for normal primary myoblast differentiation in vitro and muscle regeneration in vivo. PLoS Genet. 2017;13(2):e1006600.

    Article  PubMed  PubMed Central  Google Scholar 

  51. Benhaddou A, Keime C, Ye T, Morlon A, Michel I, Jost B, et al. Transcription factor TEAD4 regulates expression of myogenin and the unfolded protein response genes during C2C12 cell differentiation. Cell Death Differ. 2012;19(2):220–31.

    Article  CAS  PubMed  Google Scholar 

  52. Bengal E, Ransone L, Scharfmann R, Dwarki VJ, Tapscott SJ, Weintraub H, et al. Functional antagonism between c-Jun and MyoD proteins: a direct physical association. Cell. 1992;68(3):507–19.

    Article  CAS  PubMed  Google Scholar 

  53. Raffaello A, Milan G, Masiero E, Carnio S, Lee D, Lanfranchi G, et al. JunB transcription factor maintains skeletal muscle mass and promotes hypertrophy. J Cell Biol. 2010;191(1):101–13.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  54. Ge XM, Zhang YF, Jiang HL. Signaling pathways mediating the effects of insulin-like growth factor-I in bovine muscle satellite cells. Mol Cell Endocrinol. 2013;372(1–2):23–9.

    Article  CAS  PubMed  Google Scholar 

  55. Zhang Y, Cong X, Wang A, Jiang H. Identification of the STAC3 gene as a skeletal muscle-specifically expressed gene and a novel regulator of satellite cell differentiation in cattle. J Anim Sci. 2014;92(8):3284–90.

    Article  CAS  PubMed  Google Scholar 

  56. Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30(15):2114–20.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  57. Kim D, Langmead B, Salzberg SL. HISAT: a fast spliced aligner with low memory requirements. Nat Methods. 2015;12(4):357–60.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  58. Danecek P, Bonfield JK, Liddle J, Marshall J, Ohan V, Pollard MO, et al. Twelve years of SAMtools and BCFtools. Gigascience. 2021;10:2.

    Article  Google Scholar 

  59. Zhang Y, Liu T, Meyer CA, Eeckhoute J, Johnson DS, Bernstein BE, et al. Model-based Analysis of ChIP-Seq (MACS). Genome Biol. 2008;9:9.

    Article  Google Scholar 

  60. Kharchenko PV, Tolstorukov MY, Park PJ. Design and analysis of ChIP-seq experiments for DNA-binding proteins. Nat Biotechnol. 2008;26(12):1351–9.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  61. Robinson JT, Thorvaldsdottir H, Winckler W, Guttman M, Lander ES, Getz G, et al. Integrative genomics viewer. Nat Biotechnol. 2011;29(1):24–6.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  62. Yu G, Wang LG, He QY. ChIPseeker: an R/bioconductor package for ChIP peak annotation, comparison and visualization. Bioinformatics. 2015;31(14):2382–3.

    Article  CAS  PubMed  Google Scholar 

  63. Heinz S, Benner C, Spann N, Bertolino E, Lin YC, Laslo P, et al. Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Mol Cell. 2010;38(4):576–89.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  64. Mi H, Muruganujan A, Casagrande JT, Thomas PD. Large-scale gene function analysis with the PANTHER classification system. Nat Protoc. 2013;8(8):1551–66.

    Article  PubMed  PubMed Central  Google Scholar 

  65. Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, et al. Gene ontology: tool for the unification of biology. Gene Ontology Consortium Nat Genet. 2000;25(1):25–9.

    CAS  PubMed  Google Scholar 

  66. Gene Ontology C. The Gene Ontology resource: enriching a GOld mine. Nucleic Acids Res. 2021;49(D1):D325–34.

    Article  Google Scholar 

  67. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 2001;25(4):402–8.

    Article  CAS  PubMed  Google Scholar 

  68. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002;3(7):RESEARCH0034.

    Article  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

This project was supported by Agriculture and Food Research Initiative competitive grant no. 2016–67015-24471 from the USDA National Institute of Food and Agriculture.

Author information

Authors and Affiliations

  1. Department of Animal and Poultry Sciences, Virginia Tech, Blacksburg, VA, 24061, USA

    Pengcheng Lyu & Honglin Jiang

  2. Advanced Research Computing, Virginia Tech, Blacksburg, VA, 24061, USA

    Robert E. Settlage

Authors
  1. Pengcheng Lyu
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Robert E. Settlage
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Honglin Jiang
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

HJ designed the research; PL and HJ performed the experiments; PL, RES, and HJ analyzed the data; PL, RES, and HJ wrote the manuscript. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Honglin Jiang.

Ethics declarations

Ethics approval and consent to participate

The protocol involving animals used in this study was approved by the Virginia Tech Institutional Animal Care and Use Committee (IACUC number 20–169).

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1.

Assessment of ChIP-seq enrichment by Phantompeakqualtools

Additional file 2.

H3K27ac peaks specific to before-differentiation bovine satellite cells

Additional file 3.

H3K27ac peaks specific to during-differentiation bovine satellite cells

Additional file 4.

H3K27ac peaks common to both before- and during-differentiation bovine satellite cells

Additional file 5.

Top 10 GO biological processes enriched in genes associated with H3K27ac modification in before-differentiation bovine satellite cells

Additional file 6.

Top 10 GO cellular components enriched in genes associated with H3K27ac modification in before-differentiation bovine satellite cells

Additional file 7.

Top 10 GO molecular functions enriched in genes associated with H3K27ac modification in before-differentiation bovine satellite cells

Additional file 8.

Top 10 GO biological processes enriched in genes associated with H3K27ac modification in both before- and during-differentiation bovine satellite cells

Additional file 9.

Top 10 GO cellular components enriched in genes associated with H3K27ac modification in both before- and during-differentiation bovine satellite cells

Additional file 10.

Top 10 GO molecular functions enriched in genes associated with H3K27ac modification in both before- and during-differentiation bovine satellite cells

Additional file 11.

Motifs enriched in enhancers marked with H3K27ac in during-differentiation bovine satellite cells

Additional file 12.

Motifs enriched in enhancers marked with H3K27ac in before-differentiation bovine satellite cells

Additional file 13.

Motifs enriched in enhancers marked with H3K27ac in both before- and during-differentiation bovine satellite cells

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Lyu, P., Settlage, R.E. & Jiang, H. Genome-wide identification of enhancers and transcription factors regulating the myogenic differentiation of bovine satellite cells. BMC Genomics 22, 901 (2021). https://doi.org/10.1186/s12864-021-08224-7

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12864-021-08224-7

Keywords

BMC Genomics

ISSN: 1471-2164

Contact us