- Correction
- Open access
- Published:
Correction to: A cis-regulatory element promoting increased transcription at low temperature in cultured ectothermic Drosophila cells
BMC Genomics volume 23, Article number: 241 (2022)
The Original Article was published on 28 October 2021
Correction to: BMC Genomics 22, 771 (2021)
https://doi.org/10.1186/s12864-021-08057-4
Following the publication of the original article [1], the corresponding author was informed of two mistakes present in the originally published Additional file 23 Table S10. The sequences of the oligonucleotides YB320 and YB362, which were used as forward primers for amplification of the candidate CREs Hsp23_E2 and Prx2540-1_E, were not entered correctly into this table.
The correct sequence of YB320 is 5’-TAGTTGGGGATGTCTTCGAATGTACATATGTTCCAAATCG -3’ and of YB362 is 5’- TAGTTGGGGATGTCTTCCATTTAGCTCATCTCCACGCTAG -3’.
The correct Additional file 23 Table S10 is included in this Correction article and the original article [1] has been updated.
Reference
Bai, et al. A cis-regulatory element promoting increased transcription at low temperature in cultured ectothermic Drosophila cells. BMC Genomics. 2021;22(1):771. https://doi.org/10.1186/s12864-021-08057-4 .
Author information
Authors and Affiliations
Corresponding author
Supplementary Information
Additional file 23: Table S10
. Excel file with description of synthetic DNA fragments (oligos and gene blocks).
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
About this article
Cite this article
Bai, Y., Caussinus, E., Leo, S. et al. Correction to: A cis-regulatory element promoting increased transcription at low temperature in cultured ectothermic Drosophila cells. BMC Genomics 23, 241 (2022). https://doi.org/10.1186/s12864-022-08473-0
Published:
DOI: https://doi.org/10.1186/s12864-022-08473-0