Skip to content


Open Access

The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes

  • Shara Atambayeva1Email author,
  • Raigul Niyazova1,
  • Anatoliy Ivashchenko1,
  • Anna Pyrkova1,
  • Ilya Pinsky1,
  • Aigul Akimniyazova1 and
  • Siegfried Labeit2
BMC Genomics201718:428

Received: 19 March 2017

Accepted: 22 May 2017

Published: 1 June 2017



Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications.


The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3’UTR (214 sites), CDS (3 sites), and 5’UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3’UTRs. The miR-619-5p binding site in the 5’UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3’UTRs of all human target genes are also present in the 3’UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes.


The majority of miR-619-5p binding sites are located in the 3’UTRs but some genes have miRNA binding sites in the 5’UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3’UTRs, 5’UTRs and CDSs are conservative in the orthologous mammalian genes.


miR-619-5pmiRNAmRNAGeneHumanOrthologous genes


miRNAs participate in the regulation of the expression of protein-coding genes at the post-transcriptional stage [1]. miRNAs, as a part of the RNA-induced silencing complex, bind to mRNAs and interfere with translation or promote mRNA destruction [2]. In the last two decades, properties of miRNAs and their influences on the expression of the genes involved in all key cellular processes have been established. The actions of miRNAs on the cell cycle [3], apoptosis [4], differentiation [5], and growth and development of plants [6] and animals [7] have been shown. Connections between miRNA expression and the development of various diseases have been established. miRNA concentrations change in cancer [8] and cardiovascular diseases [9]. Metabolic perturbations change miRNA concentrations in cells [10]. The aforementioned roles do not encompass all of the biological processes in which miRNAs participate, which further proves the importance of their biological functions. Despite the significant success in the study of miRNA properties, there are obstacles in identifying the target genes of miRNAs. Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs, which significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. There are more than 2,500 miRNAs in the human genome, and they are believed to act on 60% or more genes. Therefore, it is difficult to draw specific conclusions about the participation of miRNAs in specific biological processes, and until then the connections between the majority of miRNAs and their target genes will remain unknown. Recently, a set of unique miRNAs (umiRNA) were identified that have hundreds of target genes and bind to mRNAs with high affinity [1114]. The binding sites of these umiRNAs are located in the 3’UTRs, CDSs, and 5’UTRs of mRNAs. Among these umiRNAs, miR-619-5p interacts with the largest number of target genes that have the greatest number of binding sites with complete complementarity of miR-619-5p and mRNAs. It is necessary to identify many miRNA binding sites in the mRNAs of these genes for the control of gene expression. Furthermore, it is important to control the expression of the corresponding gene complexes that are functionally associated with miRNAs. Therefore, we have studied a unique miR-619-5p that binds to the mRNAs of several hundred human and orthologous genes.


The nucleotide sequences of mRNAs of human genes (Homo sapience – Hsa) and orthologous genes (Bos mutus - The wild yak (Bmu), Callithrix jacchus – The common marmoset (Cja), Camelus dromedarius – Arabian camel (Cdr), Camelus ferus – The wild Bactrian camel (Cfe), Chlorocebus sabaeus – The green monkey (Csa), Colobus angolensis palliatus – The Angola colobus (Can), Equus caballus - The horse (Eca), Gorilla gorilla - The western gorilla (Ggo), Macaca fascicularis – The crab-eating macaque (Mfa), Macaca mulatta – The rhesus macaque (Mmu), Macaca nemestrina - Pig-tailed macaque (Mne), Mandrillus leucophaeus – The drill (Mle), Nomascus leucogenys - The northern white-cheeked gibbon (Nle), Ovis aries – The sheep (Oar), Pan paniscus - Bonobos (Ppa), Pan troglodytes – The common chimpanzee (Ptr), Papio anubis – The olive baboon (Pan), Pongo abelii - The Sumatran orangutan (Pab), Rhinopithecus roxellana – The golden snub-nosed monkey (Rro)) were downloaded from NCBI GenBank ( [15] in FASTA format using Lextractor002 script [11]. Nucleotide sequences of human mature miR-619-5p (GCUGGGAUUACAGGCAUGAGCC) were downloaded from the miRBase database ( [16]. The miR-619-5p binding sites in the 5’-untranslated regions (5’UTRs), the coding domain sequences (CDSs) and the 3’-untranslated regions (3’UTRs) of several genes were predicted using the MirTarget program [12]. This program defines the features of binding: a) the localization of miRNA binding sites in the 5’UTRs, the CDSs and the 3’UTRs of the mRNAs; b) the free energy of hybridization (∆G, kJ/mole). The ratio ΔG/ΔGm (%) was determined for each site (ΔGm equals the free energy of miRNA binding with its perfect complementary nucleotide sequence).


The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. The mRNAs have different miRNA binding site origins, lengths, quantities, and properties. The list of miR-619-5p target genes and the positions of binding sites are outlined in Table 1. miR-619-5p is 22 nucleotides in length and is coded by an intron of the slingshot protein phosphatase 1 (SSH1) gene, which is located on chromosome 12 [17, 18]. mRNAs of 201 genes have complete complementary binding sites for miR-619-5p (ΔG/ΔGm = 100%). Therefore, the energy of interaction of miR-619-5p with mRNA of all the genes listed in the table is the same and equal to ΔG = −121 kJ/mole.
Table 1

Positions of miR-619-5p binding sites and disease or function of target genes


Site, nt

Disease or function



Site, nt

Disease or function




prostate cancer
















breast cancer








renal carcinoma




















colon cancer








Parkinson’s D.




breast cancer




atopic asthma
































prostatic cancer








ovarian cancer








Parkinson’s D.












ovarian cancer




Alzheimer’s D.






























cerebellar ataxia








liver cirrhosis
















childhood obesity






















ovarian cancer








diabetes mellitus






childhood asthma






Parkinson’s D




Alzheimer’s D.








ovarian cancer
















bladder cancer




metabolic S.








cell transport





















Parkinson’s D.




cervical cancer








colon carcinoma




cardiovascular D.




























Parkinson’s D












pancreatic cancer




prostate cancer




colon cancer












cardiovascular D




renal carcinoma




colorectal cancer






hearing loss




sudden death




chronic hepatitis C
















breast cancer










self-rated health








colorectal cancer




colorectal cancer




breast cancer








lung cancer




breast cancer










Omenn syndrome




inherited ataxias








breast cancer


























Down syndrome
















liver disease








retinal disease




















nicotine dependence




breast cancer,




prostate cancer








bladder cancer




















ovarian cancer






















metabolic disease
























ovarian cancer












lung cancer








thyroid diseases












immune disease




colon cancer




crohn disease












colorectal cancer




immune diseases























prostate cancer




colon cancer
















ovarian cancer




pancreatic cancer




oral cancer
















Acute lung injury




colorectal cancer




















transcription factor




breast cancer




thyroid cancer
















transcription factor








transcription factor








transcription factor




breast cancer




transcription factor








transcription factor








liver diseases




Alzheimer’s D




transcription factor




breast cancer




cardiovascular D








transcription factor




pulmonary D




transcription factor





transcription factor


Notes: * - 5’UTR, **- CDS; others – 3’UTR, D - disease

The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3’UTR (214 sites), CDS (3 sites), and 5’UTR (4 sites). The mRNAs of 27 genes have four binding sites, seven genes have five binding sites, and CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites. The mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these sites are located in the 3’UTRs of mRNAs.

The target genes of the miR-619-5p carry out one or more different functions and are involved in the development of various diseases (Table 1).

The mRNAs of the C17orf75, C8orf44, CIAO1, CPM, CYP20A1, DCAF10, FKBP14, RAB3IP, SYNJ2BP, VHL genes have two complete complementary binding sites for miR-619-5p, and the mRNA of the CACNG8 gene has three such binding sites. This indicates a stronger dependence of the expression of these genes on miR-619-5p.

One of the methods to establish the credibility of the presence of miRNA binding site in the mRNA is to verify this site in the mRNAs of orthologous genes. In finding the miRNA binding sites raises the question of the level of reliability of the found sites. One effective way to establish the credibility of the binding sites is to establish binding sites in the orthologous genes and the identification of orthologous miRNA. Location of binding site in the protein coding region facilitates its conservation in evolution, especially if the corresponding oligopeptide plays an important role in the function of the protein. miR-619-5p binding sites with complete complementarity (ΔG/ΔGm is 100%) to the mRNAs of the four genes are located in the 5’UTRs (Table 2).
Table 2

Variation of positions and nucleotide sequences of miR-619-5p binding sites in the 5’UTRs of mRNAs of mammal genes




of site, nt

Nucleotide sequence

















































Notes: In the table 2-5 the bold type indicates the binding site of miR-619-5p

Before the 5’ end and after the 3’ end of miR-619-5p binding site, nucleotides are not homologous. The mRNAs of RGS3 and USP29 orthologous genes have binding sites in H. sapiens, N. leucogenys, P. abelii, M. leucophaeus, C. angolensis palliatus, G. gorilla, and R. roxellana.

miR-619-5p has two binding sites in the 5’UTRs of mRNAs of ANAPC16, CYB5D2, and PRR5 and three binding sites in the mRNA of DNASE1.

mRNAs of some genes have binding sites for miR-619-5p within their 5’UTRs and 3’UTRs or CDSs and 3’UTRs. For example, ATAD3C, C14orf182, and CYB5RL have miR-619-5p binding sites in the 5’UTRs and 3’UTRs, and C8orf44, ISY1, and ZNF714 have miR-619-5p binding sites in the CDSs and 3’UTRs.

The nucleotide sequences of miR-619-5p binding sites are located in the CDSs of the C8orf44, C8H8orf44, ISY1, ZNF429, and ZNF714 genes and encode the following oligopeptides (Table 3).
Table 3

Variation of amino acid sequences coding in miR-619-5p binding sites in the mRNAs of orthologous genes



Amino acid sequence














































C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is also present in the orthologous proteins of P. abelii, P. anubis, P. paniscus, and P. troglodytes. The mRNA of transcription factor ZNF429 and ZNF429 genes binding sites are encoded the AHACNP oligopeptide in the another reading frame. The first two oligopeptides are encoded in one open reading frame (ORF) and the amino acid sequences are highly conserved. The homologous oligonucleotide of the miR-619-5p binding site in the mRNA of ZNF714 gene codes for an oligopeptide in a different ORF.

The presence of miR-619-5p binding sites in the CDSs of five genes with different functions and the evolutionary conservation of these sites signify the role of miRNA in the regulation of the expression of these genes. The nucleotide sequences of specific regions of mRNAs of C8H8orf44, C8orf44, ISY1, ZNF429, and ZNF714 genes that contain miR-619-5p binding sites in the CDSs are homologous among themselves and to the binding sites located in the 5’UTRs and 3’UTRs.

The miRNA binding sites in the coding region, as opposed to the 3’UTR and 5’UTR, clearly demonstrate the relationship between miRNA and mRNA by their conserved amino acid sequences in orthologous proteins. miRNA binding site can be translated by two open reading frames that encode WLTPVIPA and AHACNPS oligopeptides. In the third reading frame, the miR-619-5p binding site has a stop codon. However, in the genes studied, no such sequence was found. In the absence of complete complementarity between miR-619-5p and its binding site, miR-619-5p uses a site containing the corresponding mutation in the CDS for the regulation of gene expression. Thus, a single miRNA binding site in the mRNA of various genes may correspond to three different oligopeptides. Generally, one out of these three oligopeptides is present in the proteins encoded by the orthologous genes.

ISY1 orthologous genes in H. sapiens, P. troglodytes, and N. leucogenys encode a protein containing QVRWLMPVIPALWEAEAGGSQA oligopeptide sequence (Table 4).
Table 4

Amino acid sequences coding in miR-619-5p binding sites in the mRNA of ISY1 gene of orthologous genes


Amino acid sequence

































* RAB43 - human ISY1 paralog gene

However, the RAB43 gene, which is paralogous to human ISY1, lacks the nucleotide sequence encoding the QVRWLMPVIPALWEAEAGGSQA oligopeptide. Additionally, ISY1 gene in the genomes of other animals also lacks the nucleotide sequence encoding this oligopeptide (Table 4).

Nucleotide sequences of miR-619-5p binding sites in the mRNAs of ADAM17, ALDH3A2, and ARL11 orthologous genes are shown in Table 5.
Table 5

Variation of nucleotide sequences of miR-619-5p binding sites in the 3’UTR of mRNAs of ADAM17, ALDH3A2, and ARL11 of orthologs



Position, nt

Nucleotide sequence

































































































These orthologous genes are characterized by highly conserved nucleotide sequence GGCTCATGCCTGTAATCCCAGC of miR-619-5p binding sites. This shows that the interaction of miR-619-5p with mRNAs of these genes is conserved during evolution. Some of the human miR-619-5p target genes and their corresponding orthologous genes have two miR-619-5p binding sites in their mRNAs.

Table 6 shows the nucleotide sequences of two miR-619-5p binding sites in the 3’UTR of mRNAs of ERBB3, FBLIM1, and FKBP14 orthologous genes.
Table 6

Variation of nucleotide sequences of two miR-619-5p binding sites in the 3’UTR of mRNAs of ERBB3, FBLIM1, and FKBP14 of orthologs



Position, nt

Nucleotide sequence









































































Notes: The black type indicates the binding site of miR-619-5p

Table 7 shows the degree of conservation of miR-619-5p binding sites in the 201 mRNAs of target genes. All mRNAs with complete complementarity to miR-619-5p binding sites (ΔG/ΔGm is 100%) were divided into four groups, and the frequency of occurrence of nucleotides was determined in each group. The results suggest that miR-619-5p binding sites are highly conserved. The binding site GGCTCATGCCTGTAATCCCAGC does not change and in each of the four gene groups the observed variability of nucleotides on the right and left is high.
Table 7

Variation of nucleotide sequences of mRNA region with miR-619-5p binding sites (See Additional file 1, 2, 3 and 4)


Here we have identified many miRNAs binding sites in the mRNAs of 201 human genes which indicates that umiRNAs act as coordinators of gene expression by participating in many biological processes. Previous studies have shown the influences of miRNAs on the expression of genes that encode the transcription factors [19, 20] and on the expression of proteins that participate in the cellular cycle [3, 2123], apoptosis [4, 2426], and stress responses [27]. It was shown the role of the mir-619-5p in the regulation of different pathological processes [28]. It was investigated the correlations between the expression of MALAT1 and miR-619-5p, in addition to the association between the clinicopathological features and survival outcomes of patients with stage II and III colorectal cancer tumors [28]. It was observed, that hsa-miR-619-5p and hsa-miR-1184 microRNA expression significantly increased in prostatic cancer. MicroRNA-gene-net analysis indicated that miR-619-5p and other some miRNAs had the most important and extensive regulatory function for Qi-stagnation syndromes and Qi-deficiency syndromes in coronary heart disease [29].

One or several umiRNAs regulating the expression of hundreds of genes can create a system of interconnected processes in cells and organisms. Such role of these umiRNAs is possible because they circulate in the blood and have access to nearly all cells of an organism [3032]. Our results provide the basis for studying the systemic roles of unique and normal miRNAs in the regulation of gene expression in human cells. The expression of many target genes is regulated by umiRNAs does not allow individual mRNAs of target genes to be expressed in more degree than others. The greater expression of one mRNA, the larger number of umiRNAs bind to this mRNA. This allows one umiRNA to maintain a certain balance of expression of the corresponding target genes. If umiRNA expression changes, such system is vulnerable. This will cause the development of pathology in the cell, tissue or body.


The majority of miR-619-5p binding sites are located in the 3’UTRs of mRNAs of target genes. Some genes have miRNA binding sites in the 5’UTRs of mRNAs. It is necessary to maintain nucleotide sequences of the binding site of umiRNA in the CDSs of several genes. Different genes have binding sites for miRNAs that are read in different open reading frames. Therefore, identical nucleotide sequences encode different amino acids in different proteins. In encoded proteins, these sites encode conservative oligopeptides. The binding sites of miR-619-5p in 3’UTRs, 5’UTRs and CDSs are conservative in the orthologous mammalian genes.



Coding domain sequences




Open reading frame


Unique miRNA



We thank Leducq foundation and the European Union project «Muscle Stress Relief». Also we thank PhD Berillo O. for her help in the collection of data.


This study was supported by a grant (N0491/ГФ4) from the Ministry of Education and Science, Kazakhstan Republic, SRI of Biology and Biotechnology Problems, al-Farabi Kazakh National University, and Institute for Anesthesiology and Intensive Operative Care Medical Faculty Mannheim, Mannheim, Germany.

Availability of data and materials

The data sets supporting the results of this article are included within the article and its additional files and publicly available.

Authors’ contributions

SA, RN and AI conceived of the study and drafted the manuscript. SA, RN, AI, SL, AP, IP and AA made substantial contributions to acquisition of data, to interpretation and modification of the data. All authors involved in drafting the manuscript, read and approved the final version of the manuscript.

Competing interests

The authors declares that they have no competing interests.

Consent for publication

Not applicable.

Ethics approval and consent to participate

Not applicable.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (, which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

SRI Of Biology and Biotechnology Problems, Al-Farabi Kazakh National University, Almaty, Kazakhstan
Institute for Anaesthesiology and Intensive Operative Care Medical Faculty Mannheim, Mannheim, Germany


  1. Doxakis E. Principles of miRNA-Target Regulation in Metazoan Models. Int J Mol Sci. 2013;14:16280–302.View ArticlePubMedPubMed CentralGoogle Scholar
  2. Tang G. siRNA and miRNA: an insight into RISCs. Trends Biochem Sci. 2005;30:106–14.View ArticlePubMedGoogle Scholar
  3. Luo Q, Li X, Li J, Kong X, Zhang J, Chen L, Huang Y, Fang L. MiR-15a is underexpressed and inhibits the cell cycle by targeting CCNE1 in breast cancer. Int J Oncol. 2013;43:1212–8.PubMedGoogle Scholar
  4. Li X, Chen YT, Josson S, Mukhopadhyay NK, Kim J, Freeman MR, Huang WC. MicroRNA-185 and 342 inhibit tumorigenicity and induce apoptosis through blockade of the SREBP metabolic pathway in prostate cancer cells. PLoS One. 2013;8:e70987.View ArticlePubMedPubMed CentralGoogle Scholar
  5. Qian NS, Liu WH, Lv WP, Xiang X, Su M, Raut V, Chen YL, Dong JH. Upregulated MicroRNA-92b regulates the differentiation and proliferation of EpCAM-positive fetal liver cells by targeting C/EBPß. PLoS One. 2013;8:e68004.View ArticlePubMedPubMed CentralGoogle Scholar
  6. Poethig RS. Vegetative phase change and shoot maturation in plants. Curr Top Dev Biol. 2013;105:125–52.View ArticlePubMedPubMed CentralGoogle Scholar
  7. Ling YH, Ding JP, Zhang XD, Wang LJ, Zhang YH, Li YS, Zhang ZJ, Zhang XR. Characterization of microRNAs from goat (Capra hircus) by Solexa deep-sequencing technology. Genet Mol Res. 2013;12:1951–61.View ArticlePubMedGoogle Scholar
  8. Knyazev EN, Fomicheva KA, Mikhailenko DS, et al. Plasma Levels of hsa-miR-619-5p and hsa-miR-1184 Differ in Prostatic Benign Hyperplasia and Cancer. Bull Exp Biol Med. 2016;161:108–11.View ArticlePubMedGoogle Scholar
  9. Hou J, Wang J, Lin C, Fu J, Ren J, Li L, Guo H, Han X, Liu J. Circulating MicroRNA Profiles Differ between Qi-Stagnation and Qi-Deficiency in Coronary Heart Disease Patients with Blood Stasis Syndrome. Evid Based Complement Alternat Med. 2014;2014:926962.View ArticlePubMedPubMed CentralGoogle Scholar
  10. Swaminathan S, Suzuki K, Seddiki N, Kaplan W, Cowley MJ, Hood CL, et al. Differential regulation of the Let-7 family of microRNAs in CD4+ T cells alters IL-10 expression. J Immunol. 2012;188:6238–46.View ArticlePubMedGoogle Scholar
  11. Ivashchenko A, Berillo O, Pyrkova A, Niyazova R, Atambayeva S. MiR-3960 binding sites with mRNA of human genes. Bioinformation. 2014;10(7):423–7.View ArticlePubMedPubMed CentralGoogle Scholar
  12. Ivashchenko A, Berillo O, Pyrkova A, Niyazova R, Atambayeva S. The properties of binding sites of miR-619-5p, miR-5095, miR-5096 and miR-5585-3p in the mRNAs of human genes. Biomed Res Int. 2014;2014:720715.PubMedPubMed CentralGoogle Scholar
  13. Ivashchenko A, Berillo O, Pyrkova A, Niyazova R. Binding Sites of miR-1273 Family on the mRNA of Target Genes. Biomed Res Int. 2014;2014:620530.PubMedPubMed CentralGoogle Scholar
  14. Ivashchenko A, Berillo O, Pyrkova A, Niyazova R, Atambayeva S. The binding sites of unique miRNAs in the human mRNAs. J Biotechnol. 2014;185:125–37.Google Scholar
  15. National Center for Biotechnology Information.
  16. Griffiths-Jones S, Grocock R, van Dongen S, Bateman A, Enright A. miRBase: microRNA sequences, targets and gene nomenclature. Nucleic Acids Res. 2006;34:140–4.View ArticleGoogle Scholar
  17. Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz Jr LA, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE. The colorectal microRNAome. Proc Natl Acad Sci U S A. 2006;103:3687–92.View ArticlePubMedPubMed CentralGoogle Scholar
  18. Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P. The repertoire and features of human platelet microRNAs. PLoS One. 2012;7:e50746.View ArticlePubMedPubMed CentralGoogle Scholar
  19. Cui Q, Yu Z, Pan Y, Purisima EO, Wang E. MicroRNAs preferentially target the genes with high transcriptional regulation complexity. Biochem Biophys Res Commun. 2007;352(3):733–8.View ArticlePubMedGoogle Scholar
  20. Yan L, Kang M, Qin Z, Zhang W, Li Y, Ou H. An intronic miRNA regulates expression of the human endothelial nitric oxide synthase gene and proliferation of endothelial cells by a mechanism related to the transcription factor SP-1. PLoS One. 2013;8:e70658.View ArticlePubMedPubMed CentralGoogle Scholar
  21. Wang P, Zou F, Zhang X, Li H, Dulak A, Tomko Jr RJ, Lazo JS, Wang Z, Zhang L, Yu J. microRNA-21 negatively regulates Cdc25A and cell cycle progression in colon cancer cells. Cancer Res. 2013;69:8157–65.View ArticleGoogle Scholar
  22. Cui X, Witalison EE, Chumanevich AP, Chumanevich AA, Poudyal D, et al. The induction of microRNA-16 in colon cancer cells by protein arginine deiminase inhibition causes a p53-dependent cell cycle arrest. PLoS One. 2013;8:e53791.View ArticlePubMedPubMed CentralGoogle Scholar
  23. Wang Y, Zheng X, Zhang Z, Zhou J, Zhao G, et al. MicroRNA-149 inhibits proliferation and cell cycle progression through the targeting of ZBTB2 in human gastric cancer. PLoS One. 2012;7:e41693.View ArticlePubMedPubMed CentralGoogle Scholar
  24. Wang Y, Lee CG. MicroRNA and cancer focus on apoptosis. J Cell Mol Med. 2009;13:12–23.View ArticlePubMedGoogle Scholar
  25. Li C, Hashimi SM, Good DA, Cao S, Duan W, Plummer PN, Mellick AS, Wei MQ. Apoptosis and microRNA aberrations in cancer. Clin Exp Pharmacol Physiol. 2012;39:739–46.View ArticlePubMedGoogle Scholar
  26. Lima RT, Busacca S, Almeida GM, Gaudino G, Fennell DA, Vasconcelos MH. MicroRNA regulation of core apoptosis pathways in cancer. Eur J Cancer. 2011;47:163–74.View ArticlePubMedGoogle Scholar
  27. Cawley K, Logue SE, Gorman AM, Zeng Q, Patterson J, Gupta S, Samali A. Disruption of microRNA biogenesis confers resistance to ER stress-induced cell death upstream of the mitochondrion. PLoS One. 2013;8:e73870.View ArticlePubMedPubMed CentralGoogle Scholar
  28. Qiu G, Zhang X, Zhang S, Liu P, Wu W, Zhang J, Dai S. Dysregulation of MALAT1 and miR-619-5p as a prognostic indicator in advanced colorectal carcinoma. Oncol Lett. 2016;12(6):5036–42.PubMedPubMed CentralGoogle Scholar
  29. Hou J, Wang J, Lin C, Fu J, Ren J, Li L, Guo H, Han X, Liu J. Circulating MicroRNA Profiles Differ between Qi-Stagnation and Qi-Deficiency in Coronary Heart Disease Patients with Blood Stasis Syndrome. Hindawi Publishing Corporation Evidence-Based Complementary and Alternative Medicine. 2014;2014:1–9.View ArticleGoogle Scholar
  30. Kumar S, Keerthana R, Pazhanimuthu A, Perumal P. Overexpression of circulating miRNA-21 and miRNA-146a in plasma samples of breast cancer patients. Indian J Biochem Biophys. 2013;50:210–4.PubMedGoogle Scholar
  31. Smith-Vikos T, Slack FJ. MicroRNAs circulate around Alzheimer’s disease. Genome Biol. 2013;14(7):125.View ArticlePubMedPubMed CentralGoogle Scholar
  32. Reshmi G, Chandra SS, Babu VJ, Babu PS, Santhi WS, Ramachandran S, Lakshmi S, Nair AS, Pillai MR. Identification and analysis of novel microRNAs from fragile sites of human cervical cancer: computational and experimental approach. Genomics. 2011;97:333–40.View ArticlePubMedGoogle Scholar


© The Author(s). 2017
