From an electrophoretic mobility shift assay to isolated transcription factors: a fast genomic-proteomic approach

The AGAA-motif within the xyn2 promoter is bound under glucose-repressing conditions

In vivo genomic footprinting data indicate that the transcriptional regulation of xyn2 expression involves the following cis-acting elements: a CCAAT-box, two Xyr1-binding motifs (GGGTAA and GGCTGG) known to bind Xyr1 (Xylanase regulator 1, [14]), and an AGAA-box [18, 22]. Figure 1 summarizes the architecture of the xyn2 promoter. The AGAA-box, as well as the CCAAT-box and one Xyr1-binding motif, are located on the antisense strand. The AGAA tetranucleotide is fully protected under non-inducing conditions [22]. Cell-free extract protein from H. jecorina transferred to repressing (glucose) or inducing (xylan) conditions was subjected to an EMSA using radiolabeled probes. A protein-DNA complex was readily observed using cell-free extract obtained under repressing conditions and a short oligonucleotide containing the AGAA-box (Pxyn2a, see Table 1) (Figure 1). No protein-DNA interaction was detected when cell-free extracts from inducing conditions were used (Figure 1), supporting the idea that this part of the promoter is involved in repression. If the AGAA sequence is mutated CTCC (Pxyn2aM, see Table 1), no DNA-protein complex is formed under either repressing or inducing conditions (Figure 1). This result indicates that this part of the xyn2 promoter is essential for binding a transcription factor under repressing conditions.

Name	Sequence (5' - 3')	Employment
Bxyn2p250f	Biotin-TGATGAAAGGAGAACAACTTCTAGACTG	Affinity Chromatography
Bxyn2p250r	CAGTCTAGAAGTTGTTCTCCTTTCATCA	Affinity Chromatography
CKT067	CACTCCACATGTTAAAGGCGCATTCAACCAGCTTC	EMSA/Affinity Chromatography
CKT068	GAAGCTGGTTGAATGCGCCTTTAACATGTGGAGTG	EMSA/Affinity Chromatography
Exp2488F	GGATCC GACCGCATGGCGCACAAC	Construction of p2488DBD
Exp2488R	CTCGAG TCAACAGAATCCTCTCGGGTCG	Construction of p2488DBD
Exp3151F	GGATCC GAAGAAACCGCCAAGGCGC	Construction of p3151DBD
Exp3151R	CTCGAG AGATGTGTACGTCGGGTTTTC	Construction of p3151DBD
Exp7236F	GGATCC ACACACGACCCCAACGCC	Construction of p7236DBD
Exp7236R	CTCGAG CGCGAGGGGGTTTCCATTC	Construction of p7236DBD
fltn2488f	GGTACC ATGGCACAAGCCCTCGACATTTCC	Construction of p2488
fltn2488r	GCGGCCGC TCAACAGAATCCTCTCGGGTCGAAG	Construction of p2488
LPxyn2f-FAM	FAM-TGATGAAAGGAGAACAACTTCTAGACTGGGTAAATTGGTCAATGGCCAGCCGCTC	FAM-labelled EMSA
LPxyn2r	GAGCGGCTGGCCATTGACCAATTTACCCAGTCTAGAAGTTGTTCTCCTTTCATCA	FAM-labelled EMSA
LPxyn2Mf-FAM	FAM-TGATGAAAGGAGAACAACGGAGAGACTGGGTAAATTGGTCAATGGCCAGCCGCTC	FAM-labelled EMSA
LPxyn2Mr	GAGCGGCTGGCCATTGACCAATTTACCCAGTCTCTCCGTTGTTCTCCTTTCATCA	FAM-labelled EMSA
Pxyn2af	TGATGAAAGGAGAACAACTTCTAGACTG	Radioactive EMSA
Pxyn2ar	TGAC CAGTCTAGAAGTTGTTCTCCTTTC	Radioactive EMSA
Pxyn2aMf	TGATGAAAGGAGAACAACGGAGAGACTG	Radioactive EMSA
Pxyn2aMr	TGAC CAGTCTCTCCGTTGTTCTCCTTTC	Radioactive EMSA
transkr2488f	AGCTTCCACAAACATGACGCCG	Transcript analysis
transkr2488r	CATGGCGATTTCGAGCAGTCG	Transcript analysis
transkr3500f	CTCTTCAGGTCCTTATGAAGGTCG	Transcript analysis
transkr3500r	GAGTAGCTGTCCGATCCACG	Transcript analysis
transkr3151f	GATGTCTGAGGAATCTTCAAGCGC	Transcript analysis
transkr3151r	GGAGTCTTGCTTCGATTGCGG	Transcript analysis
transkr7236f	GTGTACCTGGACCTTGCGC	Transcript analysis
transkr7236r	CTGCTTCTCCTGGGGCG	Transcript analysis

The employment of the oligonucleotides used in this study is given. Underlined bases represent introduced restriction enzyme sites or bases added for labelling. Double underlined bases indicate introduced point mutations.

Streptavidin-based isolation and identification of AGAA-binding proteins

The DNA-protein complex observed in the EMSA includes a putative repressor of xyn2 transcription (termed "Xpp1", Xylanase promoter-binding protein 1). To isolate this complex, the same batch of cell-free extracts from H. jecorina transferred to glucose was subjected to affinity chromatography. A schematic of the procedure is shown in Figure 2. Biotinylated versions of the same oligonucleotides used for the EMSA (Bxyn2p250, see Table 1) were incubated on ice with streptavidin beads (Figure 2). Under the EMSA reaction conditions, this mixture was incubated with the cell-free extract, which should include Xpp1 (Figure 2). After magnetic separation, the whole eluate was subjected to Nano-HPLC separation. The eluted peptides were monitored on the HPLC at a wavelength of 214 nm and directly applied to the mass spectrometer.

To verify that the genes encoding 2488prp, 3151prp, and 7236prp correspond to transcripts in H. jecorina, we performed RT-PCR using cDNAs obtained under inducing and non-inducing conditions. Using the primers listed in Table 1, we could clearly detect transcripts for the genes 2488prp, 3151prp, and 7236prp (Table 2).

Cloning, expression, and binding of putative AGAA-binding transcription factors of H. jecorina

Since transcripts for all three genes encoding the putative regulatory proteins were detected, the respective DNA-binding domains (DBD) were cloned and expressed as GST-fusion proteins using the pGEX-4T-2 vector and E. coli BL21-Gold. Production of the recombinant proteins was verified by SDS-PAGE (Figure 3A). All clones, two for the expression of the 3151prp DBD, three for the expression of the 7236prp DBD, and two for the expression of the 2488prp DBD, produced proteins of expected sizes (34 kD for 3151prp, 36 kD for 7236prp, and 32 kD for 2488prp). Two clones expressing GST alone were applied as controls and also produced bands of the correct size (26 kD).

The thrombin-cleaved DBD constructs were analyzed with an EMSA using an oligonucleotide covering the whole xyn2 promoter (Lpxyn2, see Table 1) or an oligonucleotide bearing the AGAA-box mutated to CTCC (Lpxyn2 M, see Table 1). FAM-labelled probes seem to demand longer probes: a FAM-labelled (shorter) Pxyn2a only gave a weak shift (data not shown). No shift was observed with the GST control or the 3151prp DBD (Figure 3B). The 7236prp DBD yielded two protein-DNA complexes, but these are rather non-specific, as they also formed with the mutated probe (Figure 3B). In contrast, the 2488prp DBD produced one slow-migrating shift that was not observed with the mutated probe (Figure 3B), indicating the formation of an AGAA-box specific DNA-protein complex. This candidate was analyzed in more detail.

The binding of 2488prp to the xyn2 promoter of H. jecorina

Because 2488prp DBD produced an AGAA-box specific shift in the EMSA (Figure 3B), the corresponding gene was subjected to in vitro translation. The accumulation of product from the in vitro translation was confirmed with SDS-PAGE of the FluoroTect™Green-labelled proteins (Figure 4A). A negative control reaction containing no DNA template produced no specific protein, but a positive control reaction containing a plasmid that codes for luciferase gave a protein band of the correct size (61 kD) (Figure 4A). Using the plasmid pMPF2488 as template in an in vitro translation experiment was also found to yield a protein band of the expected size (54 kD) (Figure 4A). Background bands of 42 kD (rabbit reticulocyte lysate protein) and 18 - 25 kD (aminoacyl tRNAs) are associated with the in vitro translation procedure (see manufacturer's guidelines). We then performed an EMSA using the in vitro translated, unlabelled 2488prp and the labelled oligonucleotides (the same as for the EMSA with DBD). No DNA-protein complex formed with the mutated probe (Lpxyn2 M, see Table 1) (Figure 4B), but one specific shift was observed with the probe lacking mutations (Lpxyn2) (Figure 4B, indicated by an arrow). This shifted band migrated more slowly than the positive control shifted band using in vitro translated Xyr1 (Figure 4B, also indicated by an arrow). Xyr1, a general hydrolase activating transcription factor in H. jecorina[14], was recently reported to bind the xyn2 promoter [18], acting as a cis-acting element near the AGAA-box, which is also present on the applied oligonucleotide. The two shifts with the fastest mobility in the reactions containing oligonucleotide Lpxyn2 and in vitro translated 2488prp or Xyr1 (Figure 4B) are background. These shifts also appear if the in vitro translation mixture is given no DNA-template or the luciferase protein (data not shown). Therefore, we conclude that 2488prp binds the AGAA-box of the xyn2 promoter in vitro.

Characterisation of 2488prp

The putative 2488prp gene encodes a protein of 505 amino acids with a predicted molecular mass of 55 kD. Sequence alignments indicate that the entire 2488prp protein has significant sequence similarity to hypothetical proteins in Nectria haematococca (GeneID: 9678588; 43%), Gibberella zeae (GeneID: 2791570; 43%), Neurospora crassa (GeneID: 3874038, 37%), Podospora anserina (GeneID: 6189947, 37%) Chaetomium globosum (GeneID: 4395593, 37%), Magnaporthe grisea (GeneID: 2675104, 36%). The most similarity was found in the C-terminal part of the protein (compare additional file 2), which includes a helix-loop-helix domain (HLH-superfamily; [27]) with an overall length of 67 amino acids (aa 397 to 461). A detailed domain analysis according to [28] revealed a basic DNA binding region (aa 397 to 406) N-terminal to two alpha-helices separated by a loop region (aa 409 to 461). The basic N-terminal region is thought to mediate high-affinity DNA-binding [29], whereas the helix-loop-helix region functions as a dimerization interface [30]. A glutamic acid at position 404 strongly indicates that 2488prp belongs to the group of E-box binding HLH proteins (3). The classical E-box is a hexameric palindrome. Interestingly, the AGAA-box overlaps with a hexameric palindrome (TCTAGA on the sense strand). Only the antisense part of this potential E-box has been reported to be protected according to in vivo footprinting experiments [18, 22]. The sense strand cannot be analyzed because the sequence extension in the linker-mediated PCR is fully determined at the TATA-box (unpublished data, Würleitner E. and Mach R.L.).

Transcription of 2488prp during cultivation in different carbon sources

In H. jecorina, the expression of the hydrolytic enzyme-encoding genes, such as xyn1, xyn2, bxl1, cbh1 (cellobiohydrolase 1), cbh2 (cellobiohydrolase 2), egl1 (endoglucanase 1), or bgl1 (β-glucosidase 1), is regulated by the general activator Xyr1, regardless of the carbon source or inducing substance [14, 31]. Nevertheless, different expression/induction patterns for these genes have been observed [17, 22]. We examined, whether the transcription of this putative regulatory protein depends on the presence of certain induction signals or various carbon sources.

After pre-cultivation, the mycelium of H. jeco rina was transferred to medium lacking a carbon source (de-repressing conditions) or to media containing 1% (w/v) glucose, glycerol (repressing conditions), D-xylose or xylan or 1.5 mM sophorose or xylobiose (inducing conditions). Cultures were incubated for 3, 5, and 24 hours. After RNA-extraction followed by cDNA synthesis, the transcript levels were analyzed via real-time PCR.

We observed that the abundance of the 2488prp transcript increases in the presence of carbon sources that repress hydrolase expression, such as glucose or glycerol, relative to de-repressing conditions (Fig 5A). Similar observations were made when comparing inducing conditions, such as growth on D-xylose or xylan or in media containing xylobiose or sophorose, with transcript forming in media containing glucose (Figure 5B, C). In all cases, it was clear that the transcription of the putative repressor 2488prp gene was downregulated. These data strongly indicate that 2488prp transcription is upregulated under repressive conditions and that this protein functions as a repressor of hydrolase transcription.

Strains and growth conditions

The ascomycete H. jecorina (T. reesei) QM9414 (ATCC 26921; a cellulase hyper-producing mutant derived from the wild-type strain QM6a [40]) was used throughout this study and maintained on malt agar. For replacement experiments, mycelia were pre-cultured in 1-L-Erlenmeyer flasks on a rotary shaker (250 rpm) at 30°C for 18 h in 250 mL of Mandels-Andreotti (MA) medium [41] supplemented with 1% (w/v) glycerol as a sole carbon source. 10⁸ conidia per litre (final concentration) were used as the inoculum. Pre-grown mycelia were washed and then equal amounts were resuspended in MA media containing 1% (w/v) glucose, glycerol, xylose or xylan as the sole carbon source or supplemented with 1.5 mM sophorose or xylobiose or without any carbon source.

E. coli JM109 (Promega, Wisconsin, US) was used for the propagation of plasmid vectors, and the strain BL21-Gold (Stratagene, La Jolla, CA) was used as the host for the production of GST (Glutathion S-transferase) fusion proteins.

Electrophoretic mobility shift assay (EMSA)

Radioactive EMSA synthetic oligonucleotides (VBC, Vienna, Austria) (Table 1) were used. After annealing, double stranded oligonucleotides were end-labelled with (*-32P)-dCTP using Klenow Polymerase (Promega) and purified with non-denaturing PAGE (polyacrylamide gel electrophoresis). The binding assays and PAGE experiments were performed essentially as described in [41]. Binding was achieved by incubating 100 μg of cell-free extract protein with 5 ng of labelled fragment for 15 min on ice. Cell-free extracts were prepared as described previously [41].

For fluorescent EMSA, the synthetic FAM-labelled oligonucleotides (MWG Biotech, Ebersberg, Germany) were annealed with their complementary oligonucleotides (Table 1) by cooking them in 200 mM Tris/HCl (pH 7.5) for 5 min and then letting them cool slowly to room temperature. The binding assay and PAGE experiments were performed as described previously [41]. Binding was achieved by incubating 100 ng of the GST fusion proteins or 60 ng of in vitro translated, unlabelled 2488prp (putative repressor protein) with 15 ng of labelled fragment for 15 min on ice. In vitro translation of the complete 2488prp protein was performed using the TNT Quick Coupled Transcription/Translation System (Promega) according to the manufacturer's instructions starting from the plasmid pMPF2488, which inserts the 2488prp structural gene into the vector pTNT (Promega). To verify the completion of the translation process by a SDS-PAGE, both 2488prp and luciferase (a control template DNA provided by Promega) were labelled using FluoroTect™Green (Promega). Gels (EMSA and SDS-PAGE) were analysed using a Typhoon 8600 variable mode imager (Amersham Bioscience, part of GE Healthcare, CT, US).

RNA-extraction, reverse transcription, transcript analyses, quantitative PCR (qPCR)

Harvested mycelia were homogenized in 1 mL peqGOLD TriFast DNA/RNA/protein purification system (PEQLAB Biotechnologie, Erlangen, Germany) using a FastPrep FP120 BIO101 ThermoSavant cell disrupter (Qbiogene, Carlsbad, US). RNA was isolated according to the manufacturer's instructions.

The synthesis of cDNA from mRNA was achieved with the RevertAid™H Minus First Strand cDNA Synthesis Kit (Fermentas, St. Leon-Rot, Germany).

All PCRs for checking transcription were performed in an iCycler iQ, Real-Time Detection System (Bio-Rad, Hercules, US). The reactions were performed in a 25 μl volume containing 1 × buffer (Promega), 2.5 mM MgCl₂, 0.1 μM forward primer, 0.1 μM reverse primer, 0.25 U Taq-polymerase (Go-taq, Promega), and a mixture of glucose and xylose-derived cDNAs (10-fold diluted) as template. The primer sequences (transkr2488f/r, transkr3151f/r, transkr3151f/r, transkr7236f/r) are given in Table 1. The PCR run included a blank (sterile, bi-distilled water instead of sample). The following PCR protocol was used: 3 min initial denaturation at 95°C, followed by 30 cycles of 15 s at 95°C, 15 s at 59°C, and 20 s at 72°C.

All qPCRs were performed in a Mastercycler^® ep realplex² (Eppendorf, Hamburg, Germany). The software realplex 2.2 was used to compile PCR protocols and define plate set-ups. All reactions were performed in triplicate. To analyze 2488prp transcription, a SYBR Green assay with an actin reference was performed using 1 × iQ SYBR Green Supermix (Bio-Rad), 0.1 μM forward primer, 0.1 μM reverse primer, and cDNA as template. Primer pairs are given in Table 1. The following PCR program was used: 3 min initial denaturation at 95°C, followed by 45 cycles of 15 s at 95°C, 15 s at 59°C and 15 s at 72°C. The data are expressed relative to the transcription of the actin gene. The data in the figures are means of three independent experiments. Error bars indicate standard deviations. These amounts always refer to one reference sample within an experiment, which is marked in the figure with an asterisk.

Isolation of DNA-binding proteins with streptavidin affinity chromatography

Biotinylated oligonucleotides (VBC, Vienna, Austria) (Bxyn2p250f/r, see Table 1) were annealed (95°C, 5 min followed by a slow cool to 35°C and then ice) and incubated with 200 μL μMACS Streptavidin Micro Beads (Miltenyi Biotec GmbH, Bergisch Gladbach, Germany) on ice for 15 min. Afterwards, 800 μL of binding mix (200 mM KCl, 200 ng/μL poly(dIdC), 200 ng/μL CKT067/CKT068, 8 mM Spermidine) and then 880 μL of cell-free extract protein were added and incubated on ice for 15 min first and then for 10 min. CKT067/CKT068 is a double-stranded DNA fragment used to titrate proteins that nonspecifically interact with DNA. This fragment and poly(dIdC) is used in a ten-fold excess of the specific probe [41]. Cell-free extracts were prepared as described previously [41]. Magnetic separation was performed according to the manufacturer's instructions after equilibration and subsequent saturation with CKT067/068 was achieved. Elution was performed with 150 μL of cold (room temperature) SDS loading buffer followed by 150 μL of hot (60 to 70°C) SDS loading buffer. The eluate was placed on ice immediately.

Nano-HPLC-separation and identification of target proteins

Prior to MS analysis, reversed phase (RP) nano-HPLC separation of the eluted peptide mixtures from an in gel digest was performed. An UltiMate™HPLC System equipped with a FAMOS autosampler, Switchos and UV detector (all Dionex, Sunnyvale, CA, US) was used. After concentration and desalting on a trapping column (Acclaim PepMap100 C18, 5 μm, 100 Å, 300 μm i.d. × 5 mm, Dionex), peptides were separated on a PepMap 100 (C18) nanocolumn (Acclaim PepMap100 C18, 3 μm, 100 Å 75 μm i.d. × 15 cm, Dionex) at a flow-rate of 275 nL/min. Peptides were eluted with a linear gradient from 0% to 50% B in 30 min formed by mixing the two solvents A (5% ACN, 0.1% FA) and B (80% ACN, 0.08% FA), followed by a high organic wash (4 min at 90% B). The quality of separation was monitored by UV absorption at 214 nm.

The outlet of the nano-HPLC system was directly coupled to a Thermo™LTQ linear ion trap mass spectrometer (Thermo Electron Corp., Waltham, MA, US). Mass spectra were acquired in positive ionization mode. The applied method consisted of seven scans; the first was used to determine the precursor ions that were investigated in the following tandem mass scans by CAD (collisionally activated dissociation) fragmentation.

Database searching

Tandem mass spectra were extracted by extract-msn (Thermo). Charge state deconvolution and deisotoping were not performed. All MS/MS samples were analyzed using Mascot (Matrix Science, London, UK; version 2.2.04). Mascot was set up to search the treeseiV2_FrozenGeneCatalog20081022.proteins.fasta.gz database (unknown version, 9143 entries), using predictions for a trypsin digest. Mascot was searched with a fragment ion mass tolerance of 0.60 Da and a parent ion tolerance of 1.5 Da. The iodoacetamide derivative of cysteine was specified in Mascot as a fixed modification. S-carbamoylmethylcysteine cyclization of the N-terminus and methionine oxidation were specified in Mascot as variable modifications.

Criteria for protein identification

Scaffold (version Scaffold-01_07_00, Proteome Software Inc., Portland, OR) was used to validate MS/MS based peptide and protein identifications. Peptide identifications were accepted if they could be established at greater than 95.0% probability as specified by the Peptide Prophet algorithm [42]. Protein identifications were accepted if they could be established at greater than 99.0% probability and contained at least three identified peptides. Protein probabilities were assigned by the Protein Prophet algorithm [43]. Proteins that contained similar peptides and could not be differentiated based on MS/MS analysis alone were grouped to satisfy the principles of parsimony.

Vector construction

Vectors for expressing the DNA-binding domains (DBD) as GST fusion proteins were constructed as follows. PCR was used to amplify the DBD coding regions using 25 μl reaction-mixtures containing 1 × buffer with MgCl₂ (Fermentas), 0.1 μM forward primer, 0.1 μM reverse primer, 0.5 U High Fidelity DNA Polymerase (Fermentas), and genomic DNA as the template. Primer sequences (Exp2488F/R, Exp3151F/R, and Exp7236F/R) are given in Table 1. The following PCR protocol was followed: 3 min initial denaturation at 95°C, followed by 30 cycles of 15 s at 95°C, 15 s at 59°C, and 15 s at 72°C. Derived amplicons (165 bp, 219 bp, and 258 bp) were inserted into plasmid pGEX-4T-2 (Amersham) via the restriction enzymes BamHI and XhoI to obtain p2488DBD, p3151DBD, and p7236DBD, respectively.

The plasmid for expressing the 2488prp full length protein as an in vitro translation product was constructed as follows. PCR was used to amplify full length cDNA as described above, but in this case, the template was a mixture of cDNAs obtained under repressing conditions (glucose). The primer sequences (fltn2488f/r) are given in Table 1. The PCR protocol was as follows: 3 min initial denaturation at 95°C, followed by 30 cycles of 15 s at 95°C, 15 s at 59°C, and 2 min at 72°C. The derived amplicon (1,479 bp) was inserted into plasmid pTNT (Promega) via the restriction enzyme KpnI and NotI to obtain pMPF2488.

Purification of the DBDs of 2488prp, 3151prp, and 7236prp as GST fusion proteins

All heterologously expressed proteins used in this study were produced as GST fusions with the pGEX system (Amersham), following the manufacturer's guidelines and using the plasmids p2488DBD, p3151DBD, and p7236DBD as templates. Expression products purified via glutathione-sepharose-columns (Amersham) were verified by SDS-PAGE (using the Mini-PROTEAN System, Bio-Rad) followed by SYPRO Ruby (Bio-Rad) staining. Thrombin cleavage was performed for 1 h at 37°C with 1 U of thrombin (Amersham), 150 mM NaCl, 2.5 mM CaCl₂, and 25 mM Tris/HCl (pH 8) plus 20% Glycerin to remove the GST moiety.