Skip to content

Advertisement

You're viewing the new version of our site. Please leave us feedback.

Learn more

BMC Genomics

Open Access

Genome reduction and potential metabolic complementation of the dual endosymbionts in the whitefly Bemisia tabaci

  • Qiong Rao1, 6,
  • Pierre-Antoine Rollat-Farnier2, 3,
  • Dan-Tong Zhu1,
  • Diego Santos-Garcia4,
  • Francisco J Silva4, 5,
  • Andrés Moya4, 5,
  • Amparo Latorre4, 5,
  • Cecilia C Klein2, 3,
  • Fabrice Vavre2,
  • Marie-France Sagot2, 3,
  • Shu-Sheng Liu1,
  • Laurence Mouton2Email author and
  • Xiao-Wei Wang1Email author
Contributed equally
BMC Genomics201516:226

https://doi.org/10.1186/s12864-015-1379-6

Received: 18 September 2014

Accepted: 21 February 2015

Published: 21 March 2015

Abstract

Background

The whitefly Bemisia tabaci is an important agricultural pest with global distribution. This phloem-sap feeder harbors a primary symbiont, “Candidatus Portiera aleyrodidarum”, which compensates for the deficient nutritional composition of its food sources, and a variety of secondary symbionts. Interestingly, all of these secondary symbionts are found in co-localization with the primary symbiont within the same bacteriocytes, which should favor the evolution of strong interactions between symbionts.

Results

In this paper, we analyzed the genome sequences of the primary symbiont Portiera and of the secondary symbiont Hamiltonella in the B. tabaci Mediterranean (MED) species in order to gain insight into the metabolic role of each symbiont in the biology of their host. The genome sequences of the uncultured symbionts Portiera and Hamiltonella were obtained from one single bacteriocyte of MED B. tabaci. As already reported, the genome of Portiera is highly reduced (357 kb), but has kept a number of genes encoding most essential amino-acids and carotenoids. On the other hand, Portiera lacks almost all the genes involved in the synthesis of vitamins and cofactors. Moreover, some pathways are incomplete, notably those involved in the synthesis of some essential amino-acids. Interestingly, the genome of Hamiltonella revealed that this secondary symbiont can not only provide vitamins and cofactors, but also complete the missing steps of some of the pathways of Portiera. In addition, some critical amino-acid biosynthetic genes are missing in the two symbiotic genomes, but analysis of whitefly transcriptome suggests that the missing steps may be performed by the whitefly itself or its microbiota.

Conclusions

These data suggest that Portiera and Hamiltonella are not only complementary but could also be mutually dependent to provide a full complement of nutrients to their host. Altogether, these results illustrate how functional redundancies can lead to gene losses in the genomes of the different symbiotic partners, reinforcing their inter-dependency.

Keywords

EndosymbiontGenome Hamiltonella Portiera WhiteflyMetabolic complementation

Background

Interactions between endosymbionts and insects are widespread in nature [1,2], and are particularly important in members of the suborder Sternorrhyncha such as whiteflies, aphids, psyllids and mealybugs. The ability of these insects to use an unbalanced food source such as plant sap is allowed by the interaction with primary bacterial endosymbionts that complement the diet by providing their host with essential amino acids [3]. These primary endosymbionts are confined in specialized host cells, the bacteriocytes, and are strictly vertically transmitted [4], leading to a parallel evolution with their insect hosts for millions of years [5-7]. One evolutionary consequence of this lifestyle is an extreme genome reduction and degradation compared to free living relatives. This convergent evolution has been observed in primary symbionts of many insects, particularly in members of the suborder Sternorrhyncha, such as Buchnera aphidicola in aphids (from 422 to 655 kb) [8,9], Carsonella ruddii in psyllids (158-166 kb) [10], Portiera aleyrodidarum in whiteflies (281-358 kb) [11-13], as well as Moranella endobia (538 kb) and Tremblaya princeps (139-171 kb) in mealybugs [6,14,15].

Besides these primary symbionts, insects often harbor secondary symbionts that are not required for their host’s survival or reproduction. Nonetheless, they can have broad and important effects on the host biology and ecology, ranging from mutualism to reproductive manipulation, which allow them to spread and be maintained in host populations [16]. These secondary symbionts are both vertically and horizontally transmitted [17,18] and inhabit a variety of tissues, including bacteriocytes. As they are intracellular, secondary symbionts also show a pattern of genome reduction but to a lesser extent than primary symbionts. Part of their genome is devoted to the biosynthesis of vitamins and cofactors. For example, Hamiltonella defensa in aphids is able to supply all the essential vitamins except for thiamine (B1) and pantothenate (B5) [19].

Interestingly, recent advances have shown that these secondary or co-resident symbionts can complement the metabolic network of the primary symbionts. For example, the pair of endosymbionts Carsonella eucalypti (primary symbiont) and Heteropsylla cubana (secondary symbiont) in psyllids exhibits strict complementarity in the biosynthesis of tryptophan [10], as is also the case in the aphid Cinara cedri where Serratia complements lineage specific gene losses of the primary endosymbiont Buchnera [20]. Similarly, the primary endosymbiont Sulcia muelleri supplies most of the essential amino acids to its hosts while the remaining ones are provided by different co-resident symbionts: Baumannia cicadellinicola in sharpshooters, Hodgkinia cicadicola in cicadas, Zinderia insecticola in spittlebugs and Nasuia deltocephalinicola in leafhoppers [21-24]. Furthermore, “Candidatus Moranella endobia” and “Candidatus Tremblaya princeps” contribute to intermediate steps of the pathways for the synthesis of amino acids [14]. These insects must thus be seen as holobionts where the full community of organisms inhabiting a host must be taken into account to understand its phenotype, including its metabolic capabilities [25]. Interestingly, comparative genomics has revealed that these losses are generally specific to some lineages of primary endosymbionts, suggesting that the ancestor was performing the lost function. The most probable evolutionary scenario is as follows. Co-infection between the primary and the secondary symbiont preceded the function loss, generating a redundancy of some metabolic functions. As selection acts at the level of the holobiont, any loss of a metabolic function in only one symbiotic partner is neutral [26,27]. Such losses in essential functions might thus lead to the observed pattern of complementation and to the inter-dependency between the symbiotic partners.

One interesting case for investigating metabolic complementation within symbiotic communities is the whitefly Bemisia tabaci Gennadius (Homoptera: Aleyrodidae). This whitefly is a complex of at least 35 cryptic species that differ in many ecological respects, including their potential for causing damage. Some of them are serious destructive pests of agricultural, horticultural and ornamental crops with worldwide distribution [28-30]. This phloem-feeding insect harbors the primary bacterial symbiont “Candidatus Portiera aleyrodidarum” (Oceanospirillales, referred as “Portiera” in this study) that is located within bacteriocytes [4], as well as a variety of secondary symbionts [31]. Portiera is an ancient symbiont of whiteflies, acquired 100-200 million years ago [32]. The recent sequencing of two genomes of Portiera for the Mediterranean (MED, formerly referred to as the ‘Q’ biotype) species and two for the Middle East Asia Minor 1 (MEAM1, formerly referred to as the ‘B’ biotype) species of B. tabaci indicate that this symbiont not only synthesizes essential amino acids but could also protect its host against oxidative stress by supplying carotenoids [11,13]. Another remarkable feature of these genomes is their extreme reduction with a size ranging from 281 to 358 kb, which is intermediate between those observed for classical primary symbionts and the most reduced ones. Such reduction opens widely the possibility that secondary symbionts complement some metabolic functions of Portiera. In whiteflies, secondary symbionts have been reported to affect the life parameters of their host including virus transmission [14], resistance to natural enemies like parasitic wasps [33], heat stress [34] and insecticides [35]. Until now, at least seven secondary symbionts of whitefly have been reported in B. tabaci, including Hamiltonella (Enterobacteriaceae), Arsenophonus (Enterobacteriaceae), Wolbachia (Rickettsiales), Rickettisia (Rickettsiales), Cardinium (Bacteroidetes), Fritschea (Chlamydiales) and Hemipteriphilus (Rickettsiales) [36,37]. They have different patterns of localization but all of them share bacteriocytes with Portiera. These frequent infections with secondary symbionts in addition to Portiera make B. tabaci an interesting model to investigate metabolic complementation within symbiotic communities. Moreover, two of them, Hamiltonella and Arsenophonus, reach almost fixation when present in the insect populations, but they have never yet been found together within the same host individual [36]. In addition, Hamiltonella was recently found to provide fitness advantage under nutritional stress conditions, making it a good candidate for analyzing complementation in B. tabaci [38].

Among the B. tabaci species complex, the MEAM1 and the MED species are the most widespread and economically important. Over the last twenty years, they have spread rapidly to more than eighty countries over six continents, highlighting their ability to adapt to various environments, and caused serious economic damages worldwide [30,39]. While MEAM1 is notorious for its survivability under extreme conditions, MED is highly resistant to some classes of pesticides, especially neonicotinoids [40]. Interestingly, Hamiltonella has so far only been detected in these two species of B. tabaci.

The aim of the present study was to acquire, analyze and study the genome sequences of Hamiltonella and Portiera. Most often B. tabaci individuals harbor more than one secondary symbiont species, which can lead to complex interactions [41]. Here, we used a natural line belonging to the MED species that only harbors Hamiltonella in addition to Portiera. The data obtained provide insights into the dynamics and evolution of symbiont genomes in intracellular ecosystems, and the mechanisms involved in the interactions among the symbiotic partners, especially in terms of metabolic complementation. They confirm that complementation in whiteflies is an on-going process, and that the co-evolution of different symbiotic partners can lead to inter-dependency.

Results and discussion

Isolation of endosymbionts and DNA amplification

PCRs performed using specific primers of Portiera, Hamiltonella, Cardinium, Wolbachia, Rickettsia, Arsenophonus and Hemipteriphilus confirmed that the MED line used in this study only harbors Portiera and Hamiltonella (data not shown). In addition, fluorescence in situ hybridization (FISH) revealed that Hamiltonella shares bacteriocytes with Porteria in this line, and disperses in the cytoplasm of bacteriocytes (Figure 1), as already observed [31]. This contrasts with the situation observed in the aphid Acyrthosiphon pisum where Hamiltonella, is localized within sheath cells and do not share the same bacteriocytes with Buchnera [42,43]. This suggests that the two endosymbionts in MED whiteflies have a more intimate relationship. The endosymbionts were isolated by micromanipulation from a single bacteriocyte cell. Bacterial DNA was amplified by multiple displacement amplification. Diagnostic PCRs were then performed using specific primers to test for the presence of the endosymbiont DNA and the absence of host nuclear DNA contamination (Additional file 1: Figure S1).
Figure 1

Fluorescent in situ hybridization (FISH) of B. tabaci nymphs using Portiera (red) and Hamiltonella (green) specific probes. (A) Portiera channel; (B) Hamiltonella channel; (C) Portiera and Hamiltonella channels on bright field channel, combined optical sections.

Sequencing and general features of the Portiera and Hamitonella genomes

Amplified symbiotic DNA was sequenced using the Illumina HiSeq 2000 sequencer and the genomes of both Portiera and Hamiltonella were independently assembled. The main features for these assemblies are summarized in Table 1. The genome of Portiera was assembled into a single contig. It has the classical characteristics of primary endosymbionts: a biased A + T content of 73.9% with a reduced genome (357,461 base pairs), but which does not reach the smaller sizes reported to date, such as for the genomes of Nasuia deltocephalinic ola (112 kb), Tremblaya princeps (139 kb), Hodgkinia cicadicola (144 kb), Carsonella ruddii (160 kb), Zinderia insecticola (209 kb) and Sulcia muelleri (246 kb), Uzinura diaspidicola (263 kb) (Table 2) [14,16,21,23,44-46]. Despite its reduced size, this genome has a relatively low percentage of coding DNA (67.4%), which is much less than the coding density of Buchnera in aphids (83%). Large intergenic regions have been shown to represent an important substrate for genome rearrangements in Portiera [12]. A total of 272 genes were predicted in the Portiera genome, and 84.5% of them (230 genes) have homologs present in GenBank. The genome encodes three rRNA genes (16S, 23S and 5S), two non-coding RNAs (rnpB, tmRNA) and 33 tRNA genes including at least one for each of the 20 amino acids (Table 3), as observed in the two other assembled Portiera genomes of the MED whitefly species and the two genomes of Portiera in the MEAM1 whitefly species [11,13,47]. The gene content is the same in all deposited genomes, the differences being only due to variations in the annotations and pseudogene detection parameters.
Table 1

General statistics and features of Portiera and Hamiltonella genomes from the MED whitefly

 

Portiera

Hamiltonella

Total number of scaffold/contig

1

92

Current genome assembly (bp)

357,461

1,800,792

Average length (bp)

-

19,574

N50 length (bp)

-

102,662

N90 length (bp)

-

15,360

Maximum contig length (bp)

-

214,721

Predicted genes

272

1,884

Assigned function genes

230

1,672

Gene average length

889

806

Coding density, %

67.4

84.4

tRNA genes

33

40

rRNA genes

3 (5S, 16S, 23S)

3 (5S, 16S, 23S)

GC content, %

26.12

40.49

Table 2

General genomic properties of representative free-living bacteria and insect symbionts

 

Chromosome size, bp

G + C, %

No. of CDS

Coding density%

Avg. CDS length

Ref.

α-proteobacteria

      

Rickettsia belli

1,522,076

31.6

1,429

85.2

908

[78]

Wolbachia pipientis

1,267,782

35.2

1,195

80.2

851

[79]

Hodgkinia cicadicola

143,795

58.4

169

91.3

777

[45]

Β-proteobacteria

      

Profftella armatur

459,399

24.2

366

88.0

1,104

[80]

Zinderia insecticola

208,564

13.5

202

89.7

926

[23]

Tremblaya princeps

138,927

58.8

121

66.1

759

[14]

Nasuia deltocephalinicola

112,091

17.1

137

91.9

752

[24]

γ-proteobacteria

      

Escherichia coli

4,641,652

50.8

4,140

85.1

954

[81]

Sodalis glossinidius

4,171,146

54.7

2,432

50.9

873

[82]

Arsenophonus nasoniae

3,567,128*

37.4

3,332

-

-

[83]

Hamiltonella defensa

2,110,331*

40.1

2,094

80.4

810

[19]

 

1,843,969

40.3

1,806

76.8

784

This study

Serratia symbiotica

1,762,765

29.2

672

38.8

1,019

[20]

Blochmannia pennsylvanicus

791,654

29.6

610

76.7

995

[84]

Blochmannia floridanus

705,557

27.4

583

83.2

1,007

[85]

Baumannia cicadellinicola

686,194

33.2

595

85.5

986

[21]

Buchnera aphidicola

640,681

26.3

564

87.0

988

[8]

 

416,380

20.2

357

85.1

992

[9]

Portiera aleyrodidarum

357,461

26.1

272

67.7

890

This study

357,472

26.1

246

67.7

984

[13]

 

358,242

26.2

256

67.6

945

[11]

 

280,663

24.7

269

94.3

984

[12]

Carsonella ruddii

159,662

16.6

182

94.1

826

[44]

Bacteroidetes

      

Uzinura diaspidicola

263,431

30.2

227

86.5

1,004

[46]

Sulcia muelleri

245,530

22.4

227

92.1

996

[86]

*Uncompleted genome.

Table 3

tRNA type of Portiera and Hamiltonella from the MED whitefly

tRNA type

Portiera anti-codon

Hamiltonella anti-codon

Ala

TGC

TGC/GGC

Arg

TCT/ACG/CCG

TCT/CCT/CCG/ACG/TCT

Asn

GTT

GTT

Asp

GTC

GTC

Cys

GCA

GCA

Gln

TTG

CTG/TTG

Glu

TTC

TTC

Gly

GCC/TCC

TCC/GCC

His

GTG

GTG

Ile

GAT

GAT

kIle

CAT

CAT

Leu

TAG/GAG/TAA

CAG/GAG/TAG/TAA/CAA

Lys

TTT

TTT/CTT

iMet

CAT

CAT

Met

CAT

CAT

Phe

GAA

GAA

Pro

TGG

TGG/GGG

Ser

TGA/GCT/GGA/CGA

GCT/GGA/TGA

Thr

CGT/TGT/AGT

TGT/GGT

Trp

CCA

CCA

Tyr

GTA

GTA

Val

GAC/TAC

TAC/GAC

The draft genome of Hamiltonella in this MED line has an approximate size of 1,800,792 bp with an average G + C content of 40.49% and comprises 92 large scaffolds (Table 1) with a N50 size of approximately 102.66 kb. As only one bacteriocyte was used for bacterial DNA extraction and amplification, the incompleteness of the Hamiltonella genome is probably due to the bias during PCR. The genome encodes a total of 1,884 putative CDSs for which 88.75% (1,672 CDSs) can be assigned to a putative biological function. A total of 40 tRNA genes including at least one for all of the 20 amino acids and five small RNAs were predicted (Table 3). The average coding gene identity with H. defensa Hd-Ap is very high (approximately 96.4% average nucleotide similarity). Globally, the general features of this genome are very similar to those of other genomes of secondary symbionts.

Functional annotation of the genomes of Portiera and Hamiltonella and metabolic reconstruction

Protein-coding genes of Portiera and Hamiltonella were classified into Clusters of Orthologous Groups (COGs) [48]. A total of 209 Portiera genes and 1,119 Hamiltonella genes were assigned to COGs (Additional file 2: Figure S2). The three most prominently represented COG categories in the Portiera genome are “Translation, ribosomal structure and biogenesis”, “Amino acid transport and metabolism”, and “Energy production and conversion” (COGs J, E, and C, respectively). These COG categories are essential for cellular metabolism of primary endosymbionts. Conversely, genes related to “RNA processing and modification”, “Chromatin structure and dynamics”, “Cell motility and Signal transduction mechanisms” (COGs A, B, N, and T, respectively) are absent from Portiera. In Hamiltonella, several COG categories are prominently represented, namely “Translation ribosomal structure and biogenesis”, “Replication, recombination and repair”, and “Cell wall/membrane/envelope biogenesis” (COGs J, L, and M, respectively) (Additional file 2: Figure S2).

The metabolic networks of the two symbionts were reconstructed and used to identify the sources needed by each symbiont (Tables 4 and 5). Portiera needs 11 different sources to produce less than 180 metabolites, while Hamiltonella needs 15 sources for less than 600 metabolites (Pearson test, p-value < 0.05), which conforms with the expectation of a more reduced and more host-dependent metabolism in this primary endosymbiont than in Hamiltonella. While most of these sources might be provided by the host, the metabolism of Hamiltonella needs some sources which would be only synthesized by Portiera. AroA is a 3-phosphoshikimate-1-carboxyvinyltransferase involved in the sixth step of the chorismate pathway, leading to the production of 5-enolpyruvyl-shikimate-3-phosphate. A mutation in the aroA gene, determined by the in silico analysis, and later confirmed by Sanger sequencing on independent samples (Additional file 3: Figure S3) suggests that 5-enolpyruvyl-shikimate-3-phosphate is a source for the Hamiltonella metabolism. Portiera can produce this source and probably export it to the secondary endosymbiont. Nevertheless, Tamas et al. [49] reported that a point mutation in a polyA tract can be rescued by transcriptional slippage and result in some functional protein. As the mutation of whitefly aroA gene is also present in the polyA tract (Additional file 3: Figure S3) and aroA is intact in the Hamiltonella from A. pisum [19], whether the whitefly aroA gene is functional or not warrants further investigation.
Table 4

Necessary sources for the metabolism of Portiera

Inputs

Class

Putative source

Proof

(Seleno-)Homocysteine

Amino acid

B. tabaci

[5]

Geranylgeranyl diphosphate

Isoprenoid

B. tabaci

PWY-5120

HCO3

Anion

B. tabaci

[10]

L-Ornithine

Amino acid

B. tabaci

[20]

L-Aspartate

Amino acid

B. tabaci and Hamiltonella

ASPARTATESYN-PWY

Erythrose-4-phosphate

Sugar Phosphate

B. tabaci and Hamiltonella

NONOXIPENT-PWY

Phosphoenol-pyruvate

Carboxylic acid

B. tabaci and Hamiltonella

GLYCOLYSIS

Farnesyl-Diphosphate

Isoprenoid

B. tabaci and Hamiltonella

PWY-5123

Ribose-5-phosphate

Sugar Phosphate

B. tabaci and Hamiltonella

NONOXIPENT-PWY

Protoheme

Heme

Mitochondria

HEME-BIOSYNTHESIS-II

The sources potentially provided by Hamiltonella have been assessed from our analyses. Most of the sources not produced by the bacterial partner are classic metabolites of eukaryotes, and the corresponding biosynthetic pathways in MetaCyc are referred. Some sources do not seem to be produced by eukaryotes, but previous works on phloemophagous insects proposed that they were acquired from the host or its diet. The same assumptions have been made in this study, and the corresponding references have been indicated in the table.

Table 5

Necessary sources for the metabolism of Hamiltonella

Metabolite

Product/Pathway

Putative source

Proof

H2S (S2O3)

(Seleno)Cysteine

B. tabaci

[87]

Pantothenate

Co-enzyme A

B. tabaci

[52]

HCO3

Fatty acids, nucleic acids etc.

B. tabaci

[10]

Dihydroneopterin

Folate

B. tabaci

[88]

P-Amino-Benzoate

Folate

B. tabaci

[89]

Glucose

Glucolysis

B. tabaci

[19]

Serine

Glycine, Cysteine etc.

B. tabaci

SERSYN-PWY

Fe2+

Heme o, general cofactor

B. tabaci

[89]

Proline

Glutamate

B. tabaci

PROSYN-PWY

E4P

Pyridoxine

B. tabaci

NONOXIPENT-PWY

SAM

Methionine

B. tabaci

PWY-5041

Protoporphyrin

Heme o

Mitochondria

HEME-BIOSYNTHESIS-II

5-ES-3P

Chorismate

Portiera

 

N-S-LL-2,6-D

Lysine

Portiera

 

Phenyl-pyruvate

Phenylalanine

Portiera

 

The sources potentially providesssssd by Portiera have been assessed from our analyses. Most of the sources not produced by the bacterial partner are classic metabolites of eukaryotes, and the corresponding biosynthetic pathways in MetaCyc are referred. Some sources do not seem to be produced by eukaryotes, but previous works on phloemophagous insects proposed that they were acquired from the host or its diet. The same assumptions have been made in this study, and the corresponding references have been indicated in the table.

Abbreviations: D-erythrose-4-phosphate (E4P); S-adenosyl methionine (SAM); 5-enolpyruvyl-shikimate-3-phosphate (5-ES-3P); N-succinyl-L,L-2,6-diaminopimelate (N-S-LL-2,6-D).

Among sources provided by the host, hydrogen sulfide is of particular interest. Indeed, while the two symbionts of the MED whitefly lack the whole gene sets for sulfur metabolism (Figure 2), cysN/cysC [bifunctional enzyme EC: 2.7.7.4, 2.7.1.25], cysQ [EC: 3.1.3.7] and cysJ [EC: 1.8.1.2] of this pathway have been identified in the whitefly transcriptome [50]. It suggests that the host whitefly or its gut microbiota might help the symbionts for sulfate reduction. Notably, the sulfate reduction pathway can transform sulfate into hydrogen sulfide, a precursor for the cysteine synthesis pathway present in Hamiltonella (Table 5).
Figure 2

Gene content of reduced genomes from symbionts [ 8 , 9 , 19 - 21 , 78 ]. Abbreviations : Bt- Bemisia tabaci, Ap- Acyrthosiphon pisum, Cc- Cinara cedri, Hc- Homalodisca coagulata; Pa- Portiera aleyrodidarum, Hd- Hamiltonella defensa, Ba- Buchnera aphidicola, Ss- Serratia symbiotica, Sm- Sulcia muelleri, Bc- Baumannia cicadellinicola.

Essential amino acid synthesis depends on within-pathway complementation between symbionts

A major metabolic contribution of symbionts in phloemophagous insects concerns the synthesis of essential amino acids. As highlighted by the COG analysis, some metabolic functions related to the biosynthesis of amino-acids have been retained in the highly reduced genome of Portiera, which contains 56 genes dedicated to this function (Additional file 4: Figure S4, Additional file 5: Table S1). Portiera is therefore able to synthesize or to participate in the synthesis of several amino acids, and especially essential ones, like other primary endosymbionts (Additional file 4: Figure S4). These results further demonstrate the evolutionary convergence between symbionts from distinct phylogenetic lineages hosted by hosts with similar diets [1,51].

However, Portiera has only two complete pathways for the synthesis of essential amino-acids (threonine and tryptophan) [11,13]. Interestingly, some of the missing genes in these pathways are present in the Hamiltonella genome (Figure 2). For example, aspC, a gene encoding an enzyme required for the phenylalanine synthesis, is missing in the genome of Portiera but is encoded by Hamiltonella. Furthermore, the genome of Portiera lacks three enzymes involved in the biosynthesis of lysine, namely dapF, lysA, which are absent, and dapB which is pseudogenized, while Hamiltonella possesses all of these genes but lacks the argD gene in the same pathway (Figure 2). As for chorismate in Hamiltonella, the production of lysine has only been recently lost in Portiera, since the entire pathway is present and intact in the Portiera of Trialeurodes vaporariorum, another member of Aleyrodidae [12]. This is consistent with the hypothesis that acquisition of secondary endosymbionts generates metabolic redundancies with the primary endosymbiont, leading to specific gene losses in both genomes [10,20]. These losses, if they affect essential functions ancestrally performed by the primary endosymbiont, can rapidly make secondary endosymbionts indispensable for the holobiont [10,20]. Nevertheless, the functions of aspC in Portiera and argD in Hamiltonella could also be performed by other aminotransferases encoded by their respective genomes, an unknown enzyme, or by an already known enzyme which would have changed or extended its prior function, as has already been proposed for other symbiotic genes [10,52]. Interestingly, the lysine (in Carsonella, Sulcia and some Buchnera) and phenylalanine (in Carsonella, Buchnera, Tremblaya and Ishikawella) pathways are often incomplete in the genomes of primary endosymbionts, and have been proposed to be in some cases complemented by the host or co-symbiont (reviewed in Hansen et al. [53]).

The host itself could also provide enzymes for completing some pathways, as has been recently shown in aphids where the host metabolism has been redirected to complement some missing reactions for amino acid synthesis in Buchnera [54], similar to what has been hypothesized to occur in the mealybugs and psyllids [6,7]. For example, it has been hypothesized that phloem-feeder hosts encode a homolog of the aspC gene allowing the production of phenylalanine [53]. The same situation might apply to B. tabaci MED for the synthesis of valine, leucine and isoleucine, for which ilvE, the gene encoding the common last enzyme of these pathways is absent from the genomes of both Portiera and Hamiltonella and has been found in the transcriptome of the MED whitefly [50].

The case of the histidine synthesis pathway is different because the genes which are not present in the genome of Portiera (hisB [EC 3.1.3.15] and hisD; [11,13]) are neither present in the Hamiltonella’s genome (Figure 2), nor have been detected in the whitefly’s transcriptome [50]. This suggests that histidine may be provided by the food. This hypothesis is relevant since previous studies indicated that this essential amino acid is present in high concentration in the phloem sap [55]. Finally, some genes involved in the synthesis of non-essential amino acids like serine and proline are missing in the genomes of both endosymbionts, but can be identified in the sequences obtained from the MED transcriptome [50]. This highlights the fact that gene losses in the symbiotic genomes can also occur when some functional redundancies exist with the host’s genome.

Portiera and Hamiltonella synthesize different vitamins and cofactors

Other types of metabolites frequently provided by the symbionts in sap-feeding insects are vitamins and cofactors. Portiera lacks almost all the genes involved in the synthesis of vitamins and cofactors (Figure 2). However, Portiera is the first symbiont reported to be able to produce carotenoids [11,13]. Interestingly, a thorough BLAST search of the whitefly transcriptome [50] suggested that the insect cannot synthesize carotenoids, unlike aphids [56]. Conversely, Hamiltonella possesses a number of gene sets (76 genes) dedicated to vitamin production, which include riboflavin (vitamin B2), NAD, pyridoxine (vitamin B6), biotin (vitamin B7), folic acid (vitamin B9) (Figure 2, Additional file 4: Figure S4, Additional file 5: Table S2). However, it is unable to produce thiamine (vitamin B1) and pantothenic acid (vitamin B5) and, in the MED transcriptome, we did not find any genes except panC for synthesizing the two missing vitamins, suggesting that whiteflies might capture thiamine and pantothenic acid from the phloem sap. Because the MED transcriptome was sequenced using the whole whitefly [50], whether the panC gene is laterally acquired by the whitefly or produced by other symbionts (bacteria) within the whitefly is still unknown.

Transport capabilities in link with exchanged metabolites

As revealed by previous analyses, the metabolic networks of both endosymbionts could be highly intertwined requiring efficient transport systems of metabolites. Compared to secondary symbionts, primary symbionts lack many genes for environmental information processing, such as membrane transport and signal transduction (Additional file 5: Table S2). In addition, most primary endosymbionts have kept only a few transporter systems although metabolite fluxes are required within the symbiotic system [57]. Indeed, the metabolism of Portiera needs amino acid, nucleic acid and isoprenoid uptake (Table 4). Moreover, the products of the metabolism of Portiera (carotenoids, essential amino acids) need also to be exported to the host.

However, the genome of Portiera encodes only eleven putative inner-membrane-located transporters (Additional file 5: Table S3). As the gene content of Portiera has quite not changed since the last ancestor between the obligate endosymbionts of B. tabaci and T. vaporarium [12], this suggests an ancient loss of transporters. The low number of transporters is of the same order of magnitude as in Buchnera Cc (12 transporters), the symbiont of Cinara cedri, and less than half of the number of transporters identified in other Buchnera genomes (30 to 34) [52]. Different hypotheses have been proposed to explain the weak number of transporters in Buchnera Cc [52]. First, this could be linked to the strong specialization of the aphid host of this symbiont (only found in cedar plants), but in our case, the large plant spectrum of B. tabaci is not consistent with this hypothesis. Second, the presence of general transporters with low affinity with the substrates, or the recruitment of transporters from the host, could compensate the losses. For example, aphid GLNT1 which transports glutamine is located in the bacteriocyte membrane instead of the symbiosomal membrane [58].

In addition, this reduction of the ancestral transporter stock can be explained by the small number of classes of chemical compounds transported by Portiera. Its genome encodes exporters/importers for all of these classes, excepted sugars, but as it is expected in Buchnera Cc, Portiera probably acquires them by passive diffusion [9]. For example, it encodes a gltP proton dependent transporter involved in Escherichia coli in the uptake of aspartate [59], a probable source of the Portiera metabolism. In addition, this transporter could also allow the uptake of the other required amino acids (Table 4). Another transporter is argO, which is normally involved in arginine export [60]. Interestingly, arginine is no more synthesized by Portiera from B. tabaci, and consequently, argO could have no more roles, or could be involved in the export of other essential amino acids synthesized by the endosymbiont. Finally, the best hits of BTQP_154 (>50% of homology) are ditE-like genes of Pseudomonas spp. The ditE permease could be involved in diterpenoid transport [61]. Thus, this transporter could be a putative candidate for the uptake of isoprenoid sources (Table 4) and the export of carotenoids.

Conclusions

The analysis of the metabolic pathways in Portiera and Hamiltonella revealed the interdependency between two partners engaged in a mutualistic relationship. First, while the two partners depend principally on sources coming from the host diet and metabolism, they could also rely on some sources they provide to each other. Second, although Portiera encodes a large number of genes in the biosynthesis of essential amino-acids, it lacks almost all genes required for the synthesis of cofactors, while the latter are likely to be produced by Hamiltonella. Third, and in addition to this complementarity in terms of provided-sources and metabolites, some strict within-pathway complementation cases have been inferred by our in silico analysis, which concern two essential amino acids (lysine and phenylalanine). These results suggest that Hamiltonella could be a primary partner of the consortium, and could functionally explain the recent results showing the benefit it provides under nutritional stress conditions [38], and allow its fixation within populations. Interestingly, Hamiltonella probably replaced the primary endosymbiont for some functions that are still assumed by Portiera in other species of B. tabaci. As Hamiltonella is probably a recent symbiont of Bemisia, it appears that both symbionts have been caught in the act of a switch towards reciprocal complementation. Emergence of dependence between the symbiotic partners is rather due to metabolic redundancies which have been eliminated, a phenomenon that led to an apparent mutualism. Nevertheless, all of these postulations are based on the analysis of Portiera and Hamiltonella draft genomes. In order to confirm this scenario and gain insights into the evolutionary dynamics and history of these interactions, this analysis should be extended to other populations of MED species associated with Arsenophonus, and to other species of B. tabaci. This could allow determining when and in which B. tabaci species Portiera lost some key elements for the holobiont functioning, and whether some secondary endosymbionts only replaced these functions, or widened the initial niche of the holobiont, making it less dependent on specific environmental sources for some metabolites.

Methods

Whitefly rearing

The B. tabaci line belonging to the MED species (mtCO1 GenBank accession no: DQ473394) was maintained on cotton Gossypium hirsutum (Malvaceae) (cv. Zhe-Mian 1793) in climate chambers at 27 ± 1°C, 14 h : 10 h (light: darkness) and 40-60% relative humidity. The purity of this whitefly line was monitored every 3-5 generations using the RAPD-PCR technique with the primer H16 (5′-TCTCAGCTGG-3′) [62]. Our previous study confirmed this line only harbors two symbionts, the primary symbiont Portiera and the secondary symbiont Hamiltonella [36].

Fluorescence in situ hybridization (FISH)

The symbiont localization was determined by performing FISH on nymphs as previously described [31,63] with symbiont-specific 16S/23S rRNA DNA probes: BTP1-Cy3 (TGTCAGTGTCAGCCCAGAAG) for Portiera and BTH-Cy5 (CCAGATTCCCAGACTTTACTCA) for Hamiltonella. The Portiera-specific probe was used for all the individuals for control. Stained samples were whole mounted and photographed on a confocal microscope (Leica). Specificity of detection was confirmed using no probe staining and RNase-digested specimen.

Purification and amplification of endosymbionts DNA from a single bacteriocyte

MED whitefly nymphs with paired, roundish and orange color bacteriome were dissected in PBS (GIBCO®, Invitrogen, USA). A single bacteriocyte was collected with a micropipette on a glass slice and symbiont cells were then isolated by Eppendorf® microcapillary using a TransferMan® NK2 micromanipulator with a CellTram Vario (Eppendorf, Germany) under an inverted microscope. To prepare the total DNA of the symbionts, the symbiont cells in PBS were amplified by multiple displacement amplification (MDA) using the Repli-g UltraFast Mini Kit (Qiagen, Germany) according to the manufacturer’s protocol, with some modifications [64]. The yield of amplified total DNA was about 300 ng per microliter.

Diagnostic PCR

The amplified DNA was checked by diagnostic PCR using primers specific for Portiera and Hamiltonella [65]. Contamination by DNA from B. tabaci was also checked by performing PCR on β-actin gene and EF1 gene. The β-actin gene primers were Actin-F (GCTGCCTCCACCTCATTAGA) and Actin-R (AGGGCGGTGATTTCCTTCT). The PCR parameters for β-Actin gene of B. tabaci were 4 min at 94°C, followed by 30 cycles of: 45 s at 94°C, 45 s at 60°C, 1 min at 72°C, and a final extension of 10 min at 72°C. The EF1 gene primers were EF-F (CGTCCCCATTTCTGGATGGCACGG) and EF-R (CATCTCGACGGACTTAACTTCAGT), and the PCR parameters for EF1 gene are described in Ghanim et al. [66].

Genome sequencing, assembly and annotation

Using the amplified endosymbiotic DNA, two paired-end libraries with an average insert size of 200 bp and 2 kb were generated and sequenced respectively, using the Illumina HiSeq 2000 sequencer according to the manufacturer’s protocols in Beijing Genomics Institute, BGI (Shenzhen, China). The reads belonging to Portiera were retrieved based on previous published Portiera genomes and then assembled using SOAPdenovo v1.05 (http://soap.genomics.org.cn/). The Portiera genome was assembled in a single circular closed contig. The rest of the reads were used for Hamiltonella assembly. By testing a range of k-mers (21, 25, 33, 37, 47, 53 and 57), we selected 33-mer as final K-mer size for assembly with default parameters. The resulted contigs were connected according to the 200 bp and 2 kb mate-paired relationships. This assembly generated a draft genome of Hamiltonella. It has an approximate size of 1,800,792 bp and comprises 92 large scaffolds. The incompleteness of the Hamiltonella genome is probably due to the bias during PCR amplification. CDSs were then predicted by Glimmer v3.0, and a homologous comparison to a nonredundant public database was performed by BLAST for function annotation. Genes were assumed to be pseudogenes if they underwent more than 20% of reduction compared to orthologs following [67]. The annotation of COGs, gene ontologies, and EC numbers was performed using SWISSPROT. We used RNAmmer and tRNAscan to identify rRNAs [68] and tRNAs [69]. tRNA genes with anticodon CAT were discriminated according to Silva et al. [70].

KEGG (Kyoto Encyclopedia of Genes and Genome) analysis

For functional categorization, the protein sequences of the symbionts were annotated by mapping to KEGG pathways. All genes of Portiera and Hamiltonella were analyzed based on BBH (bi-directional best hit) by using the KAAS tool [71], which compared the metabolic capacity of the two bacteria with the other primary and secondary symbionts (see Additional file 5: Table S2).

Metabolic complementation analysis

PathwayTools [72] was used to build the metabolic networks of both Portiera and Hamiltonella on the basis of E.C. numbers and annotations. MetExplore [73] was used to check and curate each metabolic reconstruction individually. Cytoscape was used for network visualisation [74]. Each reaction removed or corrected in MetExplore was followed by a strict manual control (see below). The refined networks were used to identify the metabolic sources in the two symbionts, i.e. the inputs which permit to produce all the different metabolites. Thus, it was important to avoid the detection of sources with no biological sense. To do this, we removed reactions which were unlikely to take place in these organisms, or which did not interest us in the case of this work. More precisely, the automatic reconstruction generated isolated reactions which do not use any inputs produced by the metabolism of either symbiont (Additional file 5: Table S4 and S5). These reactions can correspond to spontaneous reactions that have been placed in the networks because they do not need enzymes and can thus theoretically occur in all organisms. They can also correspond to enzymes that can theoretically perform different reactions. In that case only the reactions that are connected with the rest of the network were kept. Some reactions can also involve generic metabolites (“a sugar”) and were replaced by the specific metabolites (“glucose”), or removed if these specific reactions were not connected to the rest of the network. Finally, reactions that are not assumed to occur in prokaryotes were also removed. For each removed reaction in the metabolic network of a given endosymbiont, we checked that the concerned metabolites were not a product or a source of the metabolism of the other endosymbiont. Finally, to detect sources, we applied the Borenstein’s method [75] on the two metabolic reconstructions independently, using the Igraph package (R software) [76]. Some sources were due to missing reactions in the pathways. It is the case for lysine or folate biosynthesis in Hamiltonella. In order to check for the validity of these sources, the missing genes were searched on the basis of both MetaCyc and KEGG maps. For each missing reaction, we used queries based on Blast, domain identification, and enzyme name/E.C number to identify putative candidates – the last two steps were performed using the MaGe platform.

Portiera transporter analysis

Analysis of the transporters of Portiera was performed as described in Charles et al. [52]. At first, Blast was used against the Transport Classification DataBase (TCDB) in order to find a set of potential transporters and to assess their classification according to the TCDB. Then GO annotations of the homologous genes present in UniprotKB were used to identify genes involved in transport. The genes found from these two steps were manually curated. The enzymatic reactions generally need some cofactors to occur. These last are not produced by Portiera and have also to be transported inside the cell from the environment. Thus, we considered these cofactors as an additional source of the metabolism of Portiera (Additional file 5: Table S6). The Uniprot database allowed us to find the cofactors associated with the different enzymes encoded by the Portiera genome.

Nucleotide sequence accession numbers

The complete genome sequence of “Candidatus Portiera aleyrodidarum” from the MED whiteflies has been deposited at GenBank under the accession number CP007563. The draft genome of “Candidatus Hamiltonella defense” from the MED whiteflies has been deposited under the accession number AJLH00000000 [77]. The version described in this paper is the second version, AJLH02000000.

Notes

Declarations

Acknowledgements

This work was supported by grants from the National Natural Science Foundation of China (Projects 31321063 and 31390421). This work was supported by grants BFU2012-39816-C02-01 (co-financed by FEDER funds and Ministerio de Economía y Competitividad, Spain) and Prometeo 92/2009 from Generalitat Valenciana (Spain) and by EU COST Action FA0701. D.S-G. is a recipient of a contract from Prometeo 92/2009. These results have been achieved within the framework of the 1st call on Mediterranean agriculture carried out by ARIMNet, with funding from MOARD (IL), ANR (FR), INIA (ES), NAGREF-DEMETER (GR), and GDAR (TR). P. A. Rollat-Farnier is a recipient of a grant from the European Research Council under the European Community’s Seventh Framework Programme (FP7/2007-2013) / ERC grant agreement n° [247073] 10 SISYPHE. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Authors’ Affiliations

(1)
Ministry of Agriculture Key Laboratory of Agricultural Entomology, Institute of Insect Sciences, Zhejiang University
(2)
Université de Lyon, Université Lyon1, Laboratoire de Biométrie et Biologie Evolutive
(3)
Inria Grenoble Rhône-Alpes
(4)
Institut Cavanilles de Biodiversitat i Biologia Evolutiva, Universitat de València
(5)
Unidad Mixta de Investigación en Genómica y Salud FISABIO-Salud Pública and Universitat de València
(6)
School of Agriculture and Food Science, Zhejiang A & F University

References

  1. Moran NA, McCutcheon JP, Nakabachi A. Genomics and evolution of heritable bacterial symbionts. Annu Rev Genet. 2008;42:165–90.View ArticlePubMedGoogle Scholar
  2. Moya A, Pereto J, Gil R, Latorre A. Learning how to live together: genomic insights into prokaryote-animal symbioses. Nat Rev Genet. 2008;9:218–29.View ArticlePubMedGoogle Scholar
  3. Douglas AE. Nutritional interactions in insect-microbial symbioses: aphids and their symbiotic bacteria Buchnera. Annu Rev Entomol. 1998;43:17–37.View ArticlePubMedGoogle Scholar
  4. Thao ML, Baumann P. Evolutionary relationships of primary prokaryotic endosymbionts of whiteflies and their hosts. Appl Environ Microbiol. 2004;70:3401–6.View ArticlePubMed CentralPubMedGoogle Scholar
  5. Wilson ACC, Ashton PD, Calevro F, Charles H, Colella S, Febvay G, et al. Genomic insight into the amino acid relations of the pea aphid, Acyrthosiphon pisum, with its symbiotic bacterium Buchnera aphidicola. Insect Mol Biol. 2010;19 Suppl 2:249–58.View ArticlePubMedGoogle Scholar
  6. Husnik F, Nikoh N, Koga R, Ross L, Duncan RP, Fujie M, et al. Horizontal gene transfer from diverse bacteria to an insect genome enables a tripartite nested mealybug symbiosis. Cell. 2013;153:1567–78.View ArticlePubMedGoogle Scholar
  7. Sloan DB, Nakabachi A, Richards S, Qu J, Murali SC, Gibbs RA, et al. Parallel histories of horizontal gene transfer facilitated extreme reduction of endosymbiont genomes in sap-feeding insects. Mol Biol Evol. 2014;31:857–71.View ArticlePubMed CentralPubMedGoogle Scholar
  8. Shigenobu S, Watanabe H, Hattori M, Sakaki Y, Ishikawa H. Genome sequence of the endocellular bacterial symbiont of aphids Buchnera sp. APS Nature. 2000;407:81–6.View ArticleGoogle Scholar
  9. Perez-Brocal V, Gil R, Ramos S, Lamelas A, Postigo M, Michelena JM, et al. A small microbial genome: the end of a long symbiotic relationship? Science. 2006;314:312–3.View ArticlePubMedGoogle Scholar
  10. Sloan DB, Moran NA. Genome reduction and co-evolution between the primary and secondary bacterial symbionts of psyllids. Mol Biol Evol. 2012;29:3781–92.View ArticlePubMed CentralPubMedGoogle Scholar
  11. Sloan DB, Moran NA. Endosymbiotic bacteria as a source of carotenoids in whiteflies. Biol Lett. 2012;8:986–9.View ArticlePubMed CentralPubMedGoogle Scholar
  12. Sloan DB, Moran NA. The evolution of genomic instability in the obligate endosymbionts of whiteflies. Genome Biol Evol. 2013;5:783–93.View ArticlePubMed CentralPubMedGoogle Scholar
  13. Santos-Garcia D, Farnier PA, Beitia F, Zchori-Fein E, Vavre F, Mouton L, et al. Complete genome sequence of “Candidatus Portiera aleyrodidarum” BT-QVLC, an obligate symbiont that supplies amino acids and carotenoids to Bemisia tabaci. J Bacteriol. 2012;194:6654–5.View ArticlePubMed CentralPubMedGoogle Scholar
  14. McCutcheon JP, von Dohlen CD. An interdependent metabolic patchwork in the nested symbiosis of mealybugs. Curr Biol. 2011;21:1366–72.View ArticlePubMed CentralPubMedGoogle Scholar
  15. Lopez-Madrigal S, Latorre A, Porcar M, Moya A, Gil R. Mealybugs nested endosymbiosis: going into the ‘matryoshka’ system in Planococcus citri in depth. BMC Microbiol. 2013;13:74.View ArticlePubMed CentralPubMedGoogle Scholar
  16. Zchori-Fein E, Bourtzis K. Manipulative tenants: bacteria associated with arthropods. Boca Raton, USA: CRC Press; 2012.Google Scholar
  17. Sintupachee S, Milne JR, Poonchaisri S, Baimai V, Kittayapong P. Closely related Wolbachia strains within the pumpkin arthropod community and the potential for horizontal transmission via the plant. Microb Ecol. 2006;51:294–301.View ArticlePubMedGoogle Scholar
  18. Chiel E, Zchori-Fein E, Inbar M, Gottlieb Y, Adachi-Hagimori T, Kelly SE, et al. Almost there: transmission routes of bacterial symbionts between trophic levels. PLoS One. 2009;4:e4767.View ArticlePubMed CentralPubMedGoogle Scholar
  19. Degnan PH, Yu Y, Sisneros N, Wing RA, Moran NA. Hamiltonella defensa, genome evolution of protective bacterial endosymbiont from pathogenic ancestors. Proc Natl Acad Sci U S A. 2009;106:9063–8.View ArticlePubMed CentralPubMedGoogle Scholar
  20. Lamelas A, Gosalbes MJ, Manzano-Marin A, Pereto J, Moya A, Latorre A. Serratia symbiotica from the aphid Cinara cedri: a missing link from facultative to obligate insect endosymbiont. PLoS Genet. 2011;7:e1002357.View ArticlePubMed CentralPubMedGoogle Scholar
  21. Wu D, Daugherty SC, Van Aken SE, Pai GH, Watkins KL, Khouri H, et al. Metabolic complementarity and genomics of the dual bacterial symbiosis of sharpshooters. PLoS Biol. 2006;4:1079–92.View ArticleGoogle Scholar
  22. McCutcheon JP, McDonald BR, Moran NA. Convergent evolution of metabolic roles in bacterial co-symbionts of insects. Proc Natl Acad Sci U S A. 2009;106:15394–9.View ArticlePubMed CentralPubMedGoogle Scholar
  23. McCutcheon JP, Moran NA. Functional convergence in reduced genomes of bacterial symbionts spanning 200 My of evolution. Genome Biol Evol. 2010;2:708–18.PubMed CentralPubMedGoogle Scholar
  24. Bennett GM, Moran NA. Small, smaller, smallest: the origins and evolution of ancient dual symbioses in a phloem-feeding insect. Genome Biol Evol. 2013;5:1675–88.View ArticlePubMed CentralPubMedGoogle Scholar
  25. Ferrari J, Vavre F. Bacterial symbionts in insects or the story of communities affecting communities. Proc R Soc B-Biol Sci. 2011;366:1389–400.Google Scholar
  26. Vautrin E, Vavre F. Interactions between vertically transmitted symbionts: cooperation or conflict? Trends in Microbiol. 2009;17:95–9.View ArticleGoogle Scholar
  27. Vautrin E, Genieys S, Charles S, Vavre F. Do vertically transmitted symbionts co-existing in a single host compete or cooperate? A modelling approach. J Evolution Biol. 2008;21:145–61.View ArticleGoogle Scholar
  28. Dinsdale A, Cook L, Riginos C, Buckley YM, Barro PD. Refined global analysis of Bemisia tabaci (Hemiptera: Sternorrhyncha: Aleyrodoidea: Aleyrodidae) mitochondrial cytochrome oxidase 1 to identify species level genetic boundaries. Ann Entomol Soc Am. 2010;103:196–208.View ArticleGoogle Scholar
  29. De Barro PJ, Liu SS, Boykin LM, Dinsdale AB. Bemisia tabaci: A statement of species status. Annu Rev Entomol. 2011;56:1–19.View ArticlePubMedGoogle Scholar
  30. Hu J, De Barro P, Zhao H, Wang J, Nardi F, Liu SS. An extensive field survey combined with a phylogenetic analysis reveals rapid and widespread invasion of two alien whiteflies in China. PLoS One. 2011;6:e16061.View ArticlePubMed CentralPubMedGoogle Scholar
  31. Gottlieb Y, Ghanim M, Gueguen G, Kontsedalov S, Vavre F, Fleury F, et al. Inherited intracellular ecosystem: symbiotic bacteria share bacteriocytes in whiteflies. FASEB J. 2008;22:2591–9.View ArticlePubMedGoogle Scholar
  32. Baumann P. Biology of bacteriocyte-associated endosymbionts of plant sap-sucking insects. Annu Rev Microbiol. 2005;59:155–89.View ArticlePubMedGoogle Scholar
  33. Mahadav A, Gerling D, Gottlieb Y, Czosnek H, Ghanim M. Parasitization by the wasp Eretmocerus mundus induces transcription of genes related to immune response and symbiotic bacteria proliferation in the whitefly Bemisia tabaci. BMC Genomics. 2008;9:342.View ArticlePubMed CentralPubMedGoogle Scholar
  34. Brumin M, Kontsedalov S, Ghanim M. Rickettsia influences thermotolerance in the whitefly Bemisia tabaci B biotype. Insect Sci. 2011;18:57–66.View ArticleGoogle Scholar
  35. Ghanim M, Kontsedalov S. Susceptibility to insecticides in the Q biotype of Bemisia tabaci is correlated with bacterial symbiont densities. Pest Manag Sci. 2009;65:939–42.View ArticlePubMedGoogle Scholar
  36. Bing XL, Ruan YM, Rao Q, Wang XW, Liu SS. Diversity of secondary endosymbionts among different putative species of the whitefly Bemisia tabaci. Insect Sci. 2013;20:194–206.View ArticlePubMedGoogle Scholar
  37. Bing XL, Yang J, Zchori-Fein E, Wang XW, Liu SS. Characterization of a newly discovered symbiont of the whitefly Bemisia tabaci (Hemiptera: Aleyrodidae). Appl Environ Microbiol. 2013;79:569–75.View ArticlePubMed CentralPubMedGoogle Scholar
  38. Su Q, Xie W, Wang S, Wu Q, Liu B, Fang Y, et al. The endosymbiont Hamiltonella increases the growth rate of its host Bemisia tabaci during periods of nutritional stress. PLoS One. 2014;9:e89002.View ArticlePubMed CentralPubMedGoogle Scholar
  39. Rao Q, Luo C, Zhang H, Guo X, Devine GJ. Distribution and dynamics of Bemisia tabaci invasive biotypes in central China. Bull Entomol Res. 2011;101:81–8.View ArticlePubMedGoogle Scholar
  40. Rao Q, Xu YH, Luo C, Zhang HY, Jones CM, Devine GJ, et al. Characterisation of neonicotinoid and pymetrozine resistance in strains of Bemisia tabaci (Hemiptera: Aleyrodidae) from China. J Integr Agr. 2012;11:321–6.View ArticleGoogle Scholar
  41. Gueguen G, Vavre F, Gnankine O, Peterschmitt M, Charif D, Chiel E, et al. Endosymbiont metacommunities, mtDNA diversity and the evolution of the Bemisia tabaci (Hemiptera: Aleyrodidae) species complex. Mol Ecol. 2010;19:4365–78.View ArticlePubMedGoogle Scholar
  42. Sandstrom JP, Russell JA, White JP, Moran NA. Independent origins and horizontal transfer of bacterial symbionts of aphids. Mol Ecol. 2001;10:217–28.View ArticlePubMedGoogle Scholar
  43. Moran NA, Russell JA, Koga R, Fukatsu T. Evolutionary relationships of three new species of Enterobacteriaceae living as symbionts of aphids and other insects. Appl Environ Microbiol. 2005;71:3302–10.View ArticlePubMed CentralPubMedGoogle Scholar
  44. Nakabachi A, Yamashita A, Toh H, Ishikawa H, Dunbar HE, Moran NA, et al. The 160-kilobase genome of the bacterial endosymbiont Carsonella. Science. 2006;314:267.View ArticlePubMedGoogle Scholar
  45. McCutcheon JP, McDonald BR, Moran NA. Origin of an alternative genetic code in the extremely small and GC-rich genome of a bacterial symbiont. PLoS Genet. 2009;5:e1000565.View ArticlePubMed CentralPubMedGoogle Scholar
  46. Sabree ZL, Huang CY, Okusu A, Moran NA, Normark BB. The nutrient supplying capabilities of Uzinura, an endosymbiont of armoured scale insects. Environ Microbiol. 2013;15:1988–99.View ArticlePubMedGoogle Scholar
  47. Jiang ZF, Xia F, Johnson KW, Bartom E, Tuteja JH, Stevens R, et al. Genome sequences of the primary endosymbiont “Candidatus Portiera aleyrodidarum” in the whitefly Bemisia tabaci B and Q biotypes. J Bacteriol. 2012;194:6678–9.View ArticlePubMed CentralPubMedGoogle Scholar
  48. Tatusov RL, Koonin EV, Lipman DJ. A genomic perspective on protein families. Science. 1997;278:631–7.View ArticlePubMedGoogle Scholar
  49. Tamas I, Wernegreen JJ, Nystedt B, Kauppinen SN, Darby AC, Gomez-Valero L, et al. Endosymbiont gene functions impaired and rescued by polymerase infidelity at poly(A) tracts. Proc Natl Acad Sci U S A. 2008;105:14934–9.View ArticlePubMed CentralPubMedGoogle Scholar
  50. Wang XW, Luan JB, Li JM, Bao YY, Zhang CX, Liu SS. De novo characterization of a whitefly transcriptome and analysis of its gene expression during development. BMC Genomics. 2010;11:400.View ArticlePubMed CentralPubMedGoogle Scholar
  51. Lopez-Sanchez MJ, Neef A, Pereto J, Patino-Navarrete R, Pignatelli M, Latorre A, et al. Evolutionary convergence and nitrogen metabolism in Blattabacterium strain Bge, primary endosymbiont of the cockroach Blattella germanica. PLoS Genet. 2009;5:e1000721.View ArticlePubMed CentralPubMedGoogle Scholar
  52. Charles H, Balmand S, Lamelas A, Cottret L, Perez-Brocal V, Burdin B, et al. A genomic reappraisal of symbiotic function in the aphid/Buchnera symbiosis: reduced transporter sets and variable membrane organisations. PLoS One. 2011;6:e29096.View ArticlePubMed CentralPubMedGoogle Scholar
  53. Hansen AK, Moran NA. The impact of microbial symbionts on host plant utilization by herbivorous insects. Mol Ecol. 2014;23:1473–96.View ArticlePubMedGoogle Scholar
  54. Russell CW, Bouvaine S, Newell PD, Douglas AE. Shared metabolic pathways in a coevolved insect-bacterial symbiosis. Appl Environ Microbiol. 2013;79:6117–23.View ArticlePubMed CentralPubMedGoogle Scholar
  55. Douglas AE. Phloem-sap feeding by animals: problems and solutions. J Exp Bot. 2006;57:747–54.View ArticlePubMedGoogle Scholar
  56. Moran NA, Jarvik T. Lateral transfer of genes from fungi underlies carotenoid production in aphids. Science. 2010;328:624–7.View ArticlePubMedGoogle Scholar
  57. Ren Q, Paulsen IT. Comparative analyses of fundamental differences in membrane transport capabilities in prokaryotes and eukaryotes. PLoS Comput Biol. 2005;1:e27.View ArticlePubMed CentralPubMedGoogle Scholar
  58. Price DRG, Feng H, Baker JD, Bavan S, Luetje CW, Wilson ACC. Aphid amino acid transporter regulates glutamine supply to intracellular bacterial symbionts. Proc Natl Acad Sci U S A. 2014;111:320–5.View ArticlePubMed CentralPubMedGoogle Scholar
  59. Wallace B, Yang YJ, Hong JS, Lum D. Cloning and sequencing of a gene encoding a glutamate and aspartate carrier of Escherichia coli K-12. J Bacteriol. 1990;172:3214–20.PubMed CentralPubMedGoogle Scholar
  60. Nandineni MR, Gowrishankar J. Evidence for an arginine exporter encoded by yggA (argO) that is regulated by the LysR-type transcriptional regulator ArgP in Escherichia coli. J Bacteriol. 2004;186:3539–46.View ArticlePubMed CentralPubMedGoogle Scholar
  61. Martin VJ, Mohn WW. Genetic investigation of the catabolic pathway for degradation of abietane diterpenoids by Pseudomonas abietaniphila BKME-9. J Bacteriol. 2000;182:3784–93.View ArticlePubMed CentralPubMedGoogle Scholar
  62. De Barro PJ, Driver F. Use of RAPD-PCR to distinguish the B biotype from other biotypes of Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae). Aust J Entomol. 1997;36:149–52.View ArticleGoogle Scholar
  63. Gottlieb Y, Ghanim M, Chiel E, Gerling D, Portnoy V, Steinberg S, et al. Identification and localization of a Rickettsia sp. in Bemisia tabaci (Homoptera : Aleyrodidae). Appl Environ Microbiol. 2006;72:3646–52.View ArticlePubMed CentralPubMedGoogle Scholar
  64. Woyke T, Tighe D, Mavromatis K, Clum A, Copeland A, Schackwitz W, et al. One bacterial cell, one complete genome. PLoS One. 2010;5:e10314.View ArticlePubMed CentralPubMedGoogle Scholar
  65. Zchori-Fein E, Brown JK. Diversity of prokaryotes associated with Bemisia tabaci (Gennadius) (Hemiptera : Aleyrodidae). Ann Entomol Soc Am. 2002;95:711–8.View ArticleGoogle Scholar
  66. Ghanim M, Sobol I, Ghanim M, Czosnek H. Horizontal transmission of begomoviruses between Bemisia tabaci biotypes. Arthropod-Plant Interactions. 2007;1:195–204.View ArticleGoogle Scholar
  67. Lerat E, Ochman H. Recognizing the pseudogenes in bacterial genomes. Nucleic Acids Res. 2005;33:3125–32.View ArticlePubMed CentralPubMedGoogle Scholar
  68. Lagesen K, Hallin P, Rodland EA, Staerfeldt HH, Rognes T, Ussery DW. Consistent and rapid annotation of ribosomal RNA genes. Nucleic Acids Res. 2007;35:3100–8.View ArticlePubMed CentralPubMedGoogle Scholar
  69. Schattner P, Brooks AN, Lowe TM. The tRNAscan-SE, snoscan and snoGPS web servers for the detection of tRNAs and snoRNAs. Nucleic Acids Res. 2005;33:W686–689.View ArticlePubMed CentralPubMedGoogle Scholar
  70. Silva FJ, Belda E, Talens SE. Differential annotation of tRNA genes with anticodon CAT in bacterial genomes. Nucleic Acids Res. 2006;34:6015–22.View ArticlePubMed CentralPubMedGoogle Scholar
  71. Moriya Y, Itoh M, Okuda S, Yoshizawa AC, Kanehisa M. KAAS: an automatic genome annotation and pathway reconstruction server. Nucleic Acids Res. 2007;35:W182–185.View ArticlePubMed CentralPubMedGoogle Scholar
  72. Karp PD, Paley S, Romero P. The pathway tools software. Bioinformatics. 2002;18 Suppl 1:S225–232.View ArticlePubMedGoogle Scholar
  73. Cottret L, Wildridge D, Vinson F, Barrett MP, Charles H, Sagot MF, et al. MetExplore: a web server to link metabolomic experiments and genome-scale metabolic networks. Nucleic Acids Res. 2010;38:W132–137.View ArticlePubMed CentralPubMedGoogle Scholar
  74. Smoot ME, Ono K, Ruscheinski J, Wang PL, Ideker T. Cytoscape 2.8: new features for data integration and network visualization. Bioinformatics. 2011;27:431–2.View ArticlePubMed CentralPubMedGoogle Scholar
  75. Borenstein E, Kupiec M, Feldman MW, Ruppin E. Large-scale reconstruction and phylogenetic analysis of metabolic environments. Proc Natl Acad Sci U S A. 2008;105:14482–7.View ArticlePubMed CentralPubMedGoogle Scholar
  76. Csardi G, Nepusz T. The igraph software package for complex network research. Complex Systems: Inter Journal; 2012.Google Scholar
  77. Rao Q, Wang S, Su YL, Bing XL, Liu SS, Wang XW. Draft genome sequence of “Candidatus Hamiltonella defensa”, an endosymbiont of the whitefly. Bemisia tabaci J Bacteriol. 2012;194:3558.View ArticleGoogle Scholar
  78. Ogata H, La Scola B, Audic S, Renesto P, Blanc G, Robert C, et al. Genome sequence of Rickettsia bellii illuminates the role of amoebae in gene exchanges between intracellular pathogens. PLoS Genet. 2006;2:e76.Google Scholar
  79. Wu M, Sun LV, Vamathevan J, Riegler M, Deboy R, Brownlie JC, et al. Phylogenomics of the reproductive parasite Wolbachia pipientis wMel: a streamlined genome overrun by mobile genetic elements. PLoS Biol. 2004;2:e69.Google Scholar
  80. Nakabachi A, Ueoka R, Oshima K, Teta R, Mangoni A, Gurgui M, et al. Defensive bacteriome symbiont with a drastically reduced genome. Curr Biol. 2013;23:1478–84.Google Scholar
  81. Blattner FR, Plunkett 3rd G, Bloch CA, Perna NT, Burland V, Riley M, et al. The complete genome sequence of Escherichia coli K-12. Science. 1997;277:1453–62.Google Scholar
  82. Toh H, Weiss BL, Perkin SA, Yamashita A, Oshima K, Hattori M, et al. Massive genome erosion and functional adaptations provide insights into the symbiotic lifestyle of Sodalis glossinidius in the tsetse host. Genome Res. 2006;16:149–56.Google Scholar
  83. Darby AC, Choi JH, Wilkes T, Hughes MA, Werren JH, Hurst GD, et al. Characteristics of the genome of Arsenophonus nasoniae, son-killer bacterium of the wasp Nasonia. Insect Mol Biol. 2010;19 Suppl 1:75–89.Google Scholar
  84. Degnan PH, Lazarus AB, Wernegreen JJ. Genome sequence of Blochmannia pennsylvanicus indicates parallel evolutionary trends among bacterial mutualists of insects. Genome Res. 2005;15:1023–33.Google Scholar
  85. Gil R, Silva FJ, Zientz E, Delmotte F, Gonzalez-Candelas F, Latorre A, et al. The genome sequence of Blochmannia floridanus: comparative analysis of reduced genomes. Proc Natl Acad Sci U S A. 2003;100:9388–93.Google Scholar
  86. McCutcheon JP, Moran NA. Parallel genomic evolution and metabolic interdependence in an ancient symbiosis. Proc Natl Acad Sci U S A. 2007;104:19392–7.Google Scholar
  87. Zientz E, Dandekar T, Gross R. Metabolic interdependence of obligate intracellular bacteria and their insect hosts. Microbiol Mol Biol Rev. 2004;68:745–70.View ArticlePubMed CentralPubMedGoogle Scholar
  88. Cottret L, Milreu PV, Acuña V, Marchetti-Spaccamela A, Stougie L, Charles H, et al. Graph-based analysis of the metabolic exchanges between two co-resident intracellular symbionts, Baumannia cicadellinicola and Sulcia muelleri, with their insect host, Homalodisca coagulata. PLoS Comput Biol. 2010;6:e1000904.View ArticlePubMed CentralPubMedGoogle Scholar
  89. Lin H, Lou B, Glynn JM, Doddapaneni H, Civerolo EL, Chen C, et al. The complete genome sequence of “Candidatus Liberibacter solanacearum”, the bacterium associated with potato zebra chip disease. PLoS One. 2011;6:e19135.View ArticlePubMed CentralPubMedGoogle Scholar

Copyright

© Rao et al.; licensee BioMed Central. 2015

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Advertisement