Skip to content

Advertisement

  • Research article
  • Open Access

Daily rhythmicity of clock gene transcript levels in fast and slow muscle fibers from Chinese perch (Siniperca chuatsi)

Contributed equally
BMC Genomics201617:1008

https://doi.org/10.1186/s12864-016-3373-z

  • Received: 8 July 2016
  • Accepted: 2 December 2016
  • Published:

Abstract

Background

Clock genes are considered to be the molecular core of biological clock in vertebrates and they are directly involved in the regulation of daily rhythms in vertebrate tissues such as skeletal muscles. Fish myotomes are composed of anatomically segregated fast and slow muscle fibers that possess different metabolic and contractile properties. To date, there is no report on the characterization of the circadian clock system components of slow muscles in fish.

Results

In the present study, the molecular clock components (clock, arntl1/2, cry1/2/3, cry-dash, npas2, nr1d1/2, per1/2/3, rorα and tim genes) and their daily transcription levels were characterized in slow and fast muscles of Chinese perch (Siniperca chuatsi). Among the 15 clock genes, nrld2 and per3 had no daily rhythmicity in slow muscles, and cry2/3 and tim displayed no daily rhythmicity in fast muscles of the adult fish. In the slow muscles, the highest expression of the most clock paralogs occurred at the dark period except arntl1, nr1d1, nr1d2 and tim. With the exception of nr1d2 and tim, the other clock genes had an acrophase at the light period in fast muscles. The circadian expression of the myogenic regulatory factors (mrf4 and myf5), mstn and pnca showed either a positive or a negative correlation with the transcription pattern of the clock genes in both types of muscles.

Conclusions

It was the first report to unravel the molecular clock components of the slow and fast muscles in vertebrates. The expressional pattern differences of the clock genes between the two types of muscle fibers suggest that the clock system may play key roles on muscle type-specific tissue maintenance and function.

Keywords

  • Chinese perch
  • Clock genes
  • Skeletal muscle
  • Daily rhythmicity
  • Myogenic regulatory factors

Background

Fish skeletal muscles are the most abundant tissue in the body mass and play an important role in the process of certain physiological metabolism [1]. Similar to other peripheral tissues of the body, skeletal muscles have circadian rhythms [2]. These rhythms are regulated by a transcriptional-translational and post-translational feedback network termed as the molecular clock [3]. There are several major components in the molecular clock, including circadian locomotor output cycles kaput (clock), aryl hydrocarbon receptor nuclear translocator-like protein 1 (arntl1 or bmal1), cryptochrome (cry), and period protein (per) etc. [4]. Two transcriptional activation proteins of the molecular clock, namely clock and arntl1, are the basic-helix-loop-helix (bHLH) transcription factors that form into a heterodimer in the nucleus. Together, they transactivate per and cry gene expression via binding to the E-box elements (CACGTG) at their promoter sequences [57]. Per and cry then translocate into the cell nucleus, in which they inactivate clock and arntl activity, thereby repressing their own transcription. The clock mechanism plays a pivotal role in myogenesis, gene transcription, and maintenance of muscle metabolism [8, 9]. The molecular clock components have been identified in skeletal muscles and showed a circadian rhythms of expression. In addition to these clock genes, more than 2300 other genes have circadian pattern of expression in skeletal muscles. These muscle genes with circadian pattern of expression are believed to be regulated by the major molecular clock genes and the clock-controlled transcription factors [10].

Fish are excellent model species for investigating the regulation of skeletal muscle physiology in vertebrates because it has several structural features making convenient to experimental analysis [11, 12]. The slow-contracting red and fast-contracting white muscles are the two main muscle fiber types in fish [13, 14]. Particularly, they are localized into physically distinct area of the fish body. The fast muscle fibers are the main component of skeletal muscles that distribute along the spine of the whole body. Their explosive force is strong for fast swimming using energy from glycolysis [15, 16]. Slow fibers, on the other hand, contain high contents of mitochondria and their metabolism is completely aerobic [16, 17]. These unique features enable slow fibers to maintain sustained swimming and support oxygen respiration [18].

Recently, several studies have been reported on the clock rhythmicity in fish. In zebrafish, the major clock genes showed similar circadian expression patterns in fast muscles compared with the central organs, such as retina and brain [19, 20]. It has been shown that insulin-like growth factor binding proteins (igfbp3 and igfbp5b) and myogenic regulatory factor 4(mrf4) were controlled by the core clock genes in zebrafish skeletal muscles [20, 21]. In Atlantic cod fast muscles, similar circadian clock system has been identified [2]. Another myogenic regulatory factor myf5 exhibited a significant correlation with the core clock genes at the transcription levels [2]. However there is little information on the circadian clock system components in fish slow muscle. The Chinese perch (Siniperca chuatsi) is one of the most important species in aquaculture in China [22]. Its high nutritional value, high protein content and appealing taste have led to its expanded large-scale aquaculture in china [23]. In the present study, we report the characterization of circadian clock system in both fast and slow muscles of Chinese perch, and the correlation analysis between core clock gene expression and 11 myogenic related genes in the two types of muscles.

Results

Isolation of Chinese perch clock genes and their molecular characteristics

A total of 4 complete and 11 partial sequences of 15 clock genes were cloned from the skeletal muscles of Chinese perch. These include arntl1, arntl2, clock, cry1, cry2, cry3, cry-dash, npas2, nr1d1, nr1d2, per1, per2, per3, rorα and tim (Additional file 1). The full-length cDNAs of clock, cry1, per1 and nr1d2 were 3698 bp, 3476 bp, 5406 bp and 2684 bp, respectively (Fig. 1). The clock gene contained the 5′-non-coding region (5′-UTR) of 412 bp, an open reading frame (ORF) of 2697 bp and the 3’-non-coding region (3′-UTR) of 589 bp. The cry1 gene contained the 5′-UTR of 837 bp, an ORF of 1866 bp and the 3′-UTR of 773 bp. The per1 gene included the 5′-UTR of 300 bp, an ORF of 4311 bp and the 3′-UTR of 795 bp. The nr1d2 gene contained the 5′-UTR of 380 bp, an ORF of 1770 bp and the 3′-UTR of 534 bp.
Fig. 1
Fig. 1

Schematic representation of the Chinese perch clock gene structure: (a) Clock; (b) Cry; (c) Per1; (d) Nr1d2. The predicted domain structure of clock, cry1, per1 and nr1d2 are shown as above and presented below the sequence structure. The split domain of clock proteins is shown in different colors. Both clock and per1 proteins have a PAS domain. cry1 includes a photosensitive domain of DNA photolyase, and nr1d2 has a unique zinc finger structure that connects with the nuclear DNA

The conserved structural and functional domains were characterized based on the predicted protein sequences. The clock protein contains the conserved bHLH, Per-Arnt-Ser (PAS) A and PAS B domains. The amino acid sequences of these domains showed 100%, 98% and 100% similarities to those of Larimichthys crocea, respectively (Figs. 1 and 2). The per1 has a PAS domain, a G-box binding protein multifunctional mosaic region (MFMR) and a 2/3 C-terminal region of period protein. The amino acid sequences of these domains showed 99%, 91% and 93% similarities to those of L. crocea, respectively. The cry1 contains two functional domains, a flavin adenine dinucleotide (FAD)-binding domain and a DNA photolyase domain. The amino acid sequences of these two domains showed 98% and 98% similarities to those of L. crocea, respectively. The nr1d2 has two nuclear hormone receptors DNA-binding domains and the amino acid sequences of these domains showed 100% and 98% similarities to those of L. crocea, respectively.
Fig. 2
Fig. 2

Amino acid Sequences alignment of functional domains of Chinese Perch 4 clock proteins with the homologous clock proteins of other species: (a) Clock; (b) Cry1; (c) Per1; (d) Nr1d2. The box indicates the functional regions of clock proteins

The rhythmicity of clock genes during a daily cycle in fast and slow muscles

The expression pattern of the clock genes was determined for daily rhythmicity in fast and slow muscle (Tables 1 and 2, and Figs. 3 and 4). Among the 15 clock genes, nr1d2 and per3 have no daily rhythmicity in slow muscles, while cry3, npas2, and tim have no rhythmicity in fast muscle. Cry2 and cry-dash have no daily rhythmicity in neither slow nor fast muscles. In contrast, arntl1, arntl2, clock, cry1, per1, per2, nr1d1 and rorα displayed the daily rhythmicity in both fast and slow skeletal muscles. In fast muscles, transcriptional activation factors arntl1, arntl2 and clock displayed the daily rhythmicity with an acrophase during the light phase (Fig. 3). There was no much temporal difference between arntl2 and clock expression. In slow skeletal muscles, arntl1, arntl2 and clock still displayed the daily rhythmicity but arntl1 had an acrophase during the dark phase (Fig. 4). The temporal expression of arntl1 and clock showed no apparent difference. Finally, npas2 showed the daily rhythmicity with an acrophase during the light phase only in slow muscles (Fig. 4).
Table 1

Rhythmicity parameters of clock genes and muscle-related genes transcription in Chinese perch fast skeletal muscle

Gene name

Amplitude

P value

Mesor

Acrophase

ZT(h)

arntl1

0.36

0.21

0.54

2.75

10.52

arntl2

0.53

0.07

0.62

1.77

6.77

cry1

0.44

0.17

0.52

1.66

6.33

cry2

0.12

0.46

0.27

2.89

11.05

cry3

0.15

0.49

0.48

2.39

9.14

npas2

0.11

0.45

0.30

2.16

8.26

nr1d1

0.33

0.17

0.28

1.32

5.05

nr1d2

0.20

0.10

0.46

5.37

20.51

per1

0.31

0.13

0.66

2.11

8.07

per2

0.39

0.06

0.34

1.26

4.83

per3

0.25

0.16

0.27

1.36

5.21

rorα

0.16

0.20

0.28

2.86

10.91

tim

0.02

0.98

0.40

4.27

16.33

clock

0.25

0.10

0.23

1.41

5.40

crydash

0.12

0.49

0.61

2.13

8.09

foxk2

0.07

0.89

0.31

3.82

14.57

mbnl1

1.30

0.07

1.02

1.63

6.22

mrf4

0.26

0.04

0.55

2.82

10.77

mstn

0.22

0.21

0.27

0.88

3.35

murf1

0.04

0.91

0.30

3.52

13.46

myf5

0.20

0.26

0.30

0.70

2.66

myoD

0.37

0.04

0.51

1.21

4.63

myoG

0.30

0.01

0.29

1.47

5.61

pdk4

0.17

0.48

0.39

1.09

4.18

pcna

0.29

0.05

0.32

6.00

22.91

ucp3

0.05

0.91

0.28

3.38

12.92

Note: Expression levels of clock genes and muscle-related genes are highlighted in bold while they displayed daily rhythmicity. The P value is defined as the noise/signal ratio of the oscillation amplitude. Daily rhythmicity is indicated when P value is less than 0.3

Table 2

Rhythmicity parameters of clock genes and muscle-related genes transcription in Chinese perch slow skeletal muscle

Gene name

Amplitude

P value

Mesor

Acrophase

ZT(h)

arntl1

0.16

0.18

0.24

0.06

0.22

arntl2

0.18

0.29

0.33

5.49

20.96

cry1

0.49

0.01

0.42

5.53

21.12

cry2

0.13

0.64

0.42

6.19

23.65

cry3

0.18

0.084

0.27

5.41

20.66

npas2

0.24

0.25

0.34

0.71

2.69

nr1d1

0.21

0.04

0.48

1.19

4.56

nr1d2

0.19

0.37

0.40

4.99

19.08

per1

0.20

0.03

0.40

5.37

20.53

per2

0.38

0.05

0.48

5.39

20.60

per3

0.19

0.38

0.40

5.10

19.50

rorα

0.25

0.04

0.42

5.69

21.75

tim

0.21

0.21

0.60

0.04

0.16

clock

0.18

0.01

0.34

6.01

22.94

crydash

0.12

0.41

0.33

3.93

15.03

foxk2

0.14

0.29

0.23

5.58

21.32

mbnl1

0.19

0.31

0.31

5.44

20.77

mrf4

0.09

0.29

0.40

0.70

2.67

mstn

0.23

0.28

0.34

0.87

3.32

murf1

0.27

0.31

0.35

5.33

20.34

myf5

0.19

0.09

0.31

5.56

21.23

myoD

0.13

0.42

0.45

5.73

21.90

myoG

0.16

0.32

0.45

0.74

2.81

pdk4

0.16

0.34

0.31

5.96

22.78

pcna

0.26

0.02

0.35

5.25

20.05

ucp3

0.05

0.95

0.39

1.16

4.45

Note: Expression levels of clock genes and muscle-related genes are highlighted in bold while they displayed daily rhythmicity. The P value is defined as the noise/signal ratio of the oscillation amplitude. Daily rhythmicity is indicated when P value is less than 0.3

Fig. 3
Fig. 3

Expression of clock genes in fast skeletal muscles during a daily cycle. The values are mean ± SEM (n = 6) of the normalized transcript levels of each clock gene. Significant differences between time points are indicated by different lower-case letters. The line represents the periodic sinusoidal function of gene expression in a circadian cycle constructed from the periodicity parameters calculated using COSINOR. The photoperiod regime is represented by the composite block. White, black and gray, represent the light, dark and light–dark transition phases, respectively

Fig. 4
Fig. 4

Expression of clock genes in slow skeletal muscles during a daily cycle. The values are mean ± SEM (n = 6) of the normalized transcript levels of each clock gene. Significant differences between time points are indicated by different lower-case letters. The line represents the periodic sinusoidal function of gene expression in a circadian cycle constructed from the periodicity parameters calculated using COSINOR. The photoperiod regime is represented by the composite block. White, black and gray, represent the light, dark and light–dark transition phases, respectively

The transcriptional repressors cry2, cry3 and tim were arrhythmic but cry1, per1, per2 and per3 were rhythmic in fast muscles. With the exception of tim, the other clock genes were expressed with the acrophase during the light phase in fast muscles. In slow muscles, the cry2 and per3 were arrhythmic but cry1, cry3, per1, per2 and tim were rhythmic. The tim was highly expressed during the light phase with the acrophase at Zeitgeber time (ZT) = 0.16 h, but the other genes were expressed with the acrophase during the dark phase in slow muscles.

The nuclear receptors rorα, nr1d1 and nr1d2 displayed the daily rhythmicity in fast muscles. rorα and nr1d1 had an acrophase during the light phase (ZT = 5.05 h) but nr1d2 had an acrophase during the dark phase (ZT = 20.51 h). In slow muscles, rorα and nr1d1 exhibited a daily rhythmic expression but nr1d2 was arrhythmic. The rorα and nr1d1 genes had an acrophase during the light phase, but nr1d2 exhibited a similar process during the dark phase (ZT = 19.08 h).

In fast muscles, the mRNA transcript levels of clock were positively correlated with the expression pattern of per2 and per3 in fast muscles with a higher correlation index (r > 0.8; Table 3). Arntl2 also exhibited a positive correlation with per2 and per3. Nr1d2, however, showed a moderate negative correlation to arntl1, clock, npas2, nr1d1and rorα. In slow muscles,clock showed a moderate positive correlation to per2 and per3. Arntl2 also displayed a moderate positive correlation with per2 expression. Nr1d2 showed no correlation with other genes (Table 4).
Table 3

The expression correlations among different clock genes in fast muscle during a daily cycle

Correlations

Gene

Gene

r

Positive correlation

arntl1

arntl2

+0.64

arntl1

cry1

+0.58

arntl1

cry2

+0.93

arntl1

npas2

+0.88

arntl1

per1

+0.66

arntl1

per3

+0.53

arntl1

rorα

+0.99

arntl2

cry1

+0.94

arntl2

cry2

+0.61

arntl2

cry3

+0.66

arntl2

npas2

+0.76

arntl2

nr1d1

+0.74

arntl2

per1

+0.83

arntl2

per2

+0.86

arntl2

per3

+0.83

arntl2

clock

+0.82

arntl2

rorα

+0.64

clock

npas2

+0.68

clock

per1

+0.72

clock

per2

+0.98

clock

per3

+0.98

clock

nr1d1

+0.98

clock

cry1

+0.94

cry1

npas2

+0.74

cry1

nr1d1

+0.89

cry1

per1

+0.79

cry1

per2

+0.94

cry1

per3

+0.93

cry1

rorα

+0.60

cry2

cry3

+0.60

cry2

npas2

+0.87

cry2

per1

+0.58

cry2

rorα

+0.94

cry3

per1

+0.54

npas2

nr1d1

+0.69

npas2

per1

+0.69

npas2

per2

+0.66

npas2

per3

+0.76

npas2

rorα

+0.90

nr1d1

per1

+0.63

nr1d1

per2

+0.95

nr1d1

per3

+0.98

per1

tim

+0.50

per1

per2

+0.68

per1

per3

+0.72

per1

rorα

+0.67

per2

per3

+0.97

per3

rorα

+0.53

Negative correlation

arntl1

nr1d2

−0.55

clock

nr1d2

−0.55

npas2

nr1d2

−0.52

nr1d1

nr1d2

−0.56

nr1d2

rorα

−0.52

Note: Only correlations with r > +0.5 or r < −0.5 and including at least one gene with significant daily rhythmicity are shown in this table. The following values were set to define the degree of correlation: data are moderately correlated if 0.5 < r < 0.79 and there is a strong correlation when r ≥ 0.80 which are highlighted in bold

Table 4

The expression correlations among different clock genes in slow muscle during a daily cycle

Correlations

Gene

Gene

r

Positive correlation

arntl1

arntl2

0.84

arntl1

cry2

0.51

arntl1

clock

0.77

arntl1

npas2

0.84

arntl1

nr1d2

0.55

arntl1

per1

0.74

arntl1

per3

0.68

arntl2

clock

0.70

arntl2

cry1

0.53

arntl2

cry2

0.50

arntl2

cry3

0.73

arntl2

npas2

0.56

arntl2

nr1d2

0.89

arntl2

per1

0.85

arntl2

per2

0.62

arntl2

per3

0.84

clock

cry1

0.75

clock

cry3

0.62

clock

npas2

0.56

clock

per1

0.74

clock

per2

0.61

clock

per3

0.58

clock

rorα

0.54

clock

tim

0.62

cry1

per1

0.51

cry1

per2

0.92

cry2

per2

0.58

cry3

nr1d2

0.78

cry3

per1

0.64

cry3

per2

0.83

cry3

per3

0.55

npas2

per1

0.54

npas2

per3

0.62

npas2

tim

0.63

nr1d2

per1

0.72

nr1d2

per2

0.56

per1

per2

0.51

per1

per3

0.88

per1

rorα

0.61

rorα

tim

0.61

Note: Only correlations with r > +0.5 or r < −0.5 and including at least one gene with significant daily rhythmicity are shown in this table. The following values were set to define the degree of correlation: data are moderately correlated if 0.5 < r < 0.79 and there is a strong correlation when r ≥ 0.80 which are highlighted in bold

Daily expression of myogenic related genes and the correlation with the clock components in fast and slow muscles

In fast muscles, mbnl1, mrf4, mstn, myf5, myoD, myoG and pcna displayed a daily rhythmic expression (Table 1 and Fig. 5), but only pcna had an acrophase during the dark phase (ZT = 22.91 h). In slow muscles, foxk2, mrf4, mstn, myf5 and pcna exhibited a daily rhythmic expression (Table 2 and Fig. 6). Mrf4 and mstn showed an acrophase during the light phase (ZT = 2.67 h and 3.32 h). In contrast, foxk2 (ZT = 21.32 h), myf5 (ZT = 21.23 h) and pcna (ZT = 20.05 h) had an acrophase during the dark phase.
Fig. 5
Fig. 5

Expression of myogenesis-related genes in fast skeletal muscles during a daily cycle. The values are mean ± SEM (n = 6) of the normalized transcript levels of each clock gene. Significant differences between time points are indicated by different letter notations. The line represents the periodic sinusoidal function of gene expression in a circadian cycle constructed from the periodicity parameters calculated using COSINOR. The photoperiod regime is represented by the composite block above the graph. White, black and gray represent the light, the dark and the light–dark transition phases, respectively

Fig. 6
Fig. 6

Expression of myogenesis-related genes in slow skeletal muscles during a daily cycle. The values are mean ± SEM (n = 6) of the normalized transcript levels of each clock gene. Significant differences between time points are indicated by different letter notations. The line represents the periodic sinusoidal function of gene expression in a circadian cycle constructed from the periodicity parameters calculated using COSINOR. The photoperiod regime is represented by the composite block above the graph. White, black and gray represent the light, the dark and the light–dark transition phases, respectively

The mRNA transcript levels of most myogenic related genes had either a positive or a negative correlation with the daily expression of clock genes in fast and slow muscles (Tables 5 and 6). In fast muscles, the transcript levels of pcna displayed a moderate negative correlation with arntl2, cry1 and per1 (−0.8 < r < −0.5). Mbnl1 showed a strong positive correlation with the daily expression of arntl2, cry1, nr1d1, per2, per3 and clock (r > 0.8). MyoG was also positively correlated with arntl2 and per2. In slow muscles, the transcript levels of pcna showed a moderate positive correlation with arntl2, cry1 and per1. myf5, mrf4, pcna and mstn showed a strong positive correlation with cry3 and npas2 in slow muscles. The foxk2 gene also showed a strong correlation with transcriptional activators, such as arm arntl2.
Table 5

Correlation of expression levels of rhythmic clock and muscle-related genes in the fast muscle

Note: The following values were set to define the degree of correlation: data are considered to be moderately correlated if 0.5 < r < 0.79 or −0.79 < r < −0.5 and there is a strong correlation when r ≥ 0.80. And moderate correlation is marked in bold and strong correlation in red color

Table 6

Correlation of expression levels of rhythmic clock and muscle-related genes in the slow muscle

Note: The following values were set to define the degree of correlation: data are considered to be moderately correlated if 0.5 < r < 0.79 or −0.79 < r < −0.5 and there is a strong correlation when r ≥ 0.80. And moderate correlation is marked in bold and strong correlation in red color

Discussion

In the present study, we identified for the first time 15 clock genes, including four transcriptional activation factors (arntl1, arntl2, clock and npas2), eight transcriptional repressors (cry1, cry2, cry3, cry-dash, per1, per2, per3 and tim), and three orphan nuclear receptors (nr1d1, nr1d2 and rorα) in Chinese perch skeletal muscles. As expected, some of the clock genes exhibited a robust oscillation during the light–dark cycle in the slow or fast skeletal muscle.

The full length cDNA sequences of several key clock genes, such as clock, cry1, per1 and nr1d2, were cloned from Chinese perch. Silico structural analysis of the deduced amino acid sequences indicated that clock and per1 proteins contain the conserved PAS and bHLH domains [24]. These two domains are required for the circadian clock functions and are highly conserved in different species during evolution [25]. The transcriptional repressor cry1 has a typical DNA-photolyase and flavin adenine dinucleotide(FAD)-binding domains that are present in all cryptochrome genes [26, 27]. Together with photolyase DNA repair enzymes, FAD-binding domain containing proteins form the cryptochrome/photolyase complex. This active complex has been used in blue light-induced gene expression to affect biological rhythm [26, 28, 29]. In nr1d2 protein, two core nuclear domains were also identified from its deduced amino acid sequence. The nr1d2 binds to arntl1 and clock via a unique zinc finger structure domain to form a complex, which binds and blocks the protein complex formation by Circadian Locomotor Cycles [30, 31].

The daily rhythmicity was observed in many clock genes in fast muscles of several species, indicating a potential regulatory function in muscle physiology and metabolism ([2, 20, 32], and [33]). However, the circadian clock gene expression in slow muscles has not been reported. In the study, we analyzed the arntl1 and arntl2 gene expression in Chinese perch and showed that they exhibited a light-biased expression in fast muscles. Several earlier reports in rainbow trout and mouse suggested that the photosensitivity profile in fast muscles is regulated by their homologous expression in either central or peripheral clocks ([10, 34, 35]). However, their dark-biased expression in Chinese perch slow muscle is similar to that observed in Atlantic cod and zebrafish fast muscles. The correlation between arntl1/2 and clock/npas2 in Chinese perch slow muscles indicated that the mechanism underlying the transcriptional activation of the clock system may be similar to those reported from other fish species in slow muscles. Npas2 which shares a high sequence homology with clock protein is able to substitute for clock function in the master brain clock and regulates the circadian rhythmicity in the brain. The antiphase profile between arntl and clock in Chinese perch fast muscles suggested that arntl may correlate with other bHLH-PAS factors in fish muscles.

Among the 3 period genes expressed in Chinese perch slow muscles, their dark-biased expression was in agreement with that reported from other fish species, such as goldfish, European sea bass and zebrafish [20, 28, 36, 37]. On the other hand, their light-biased expression in Chinese perch fast muscle is also consistent with the central and peripheral clocks in Senegalese sole [24]. The three period genes with the daily rhythmic expression also displayed a positive correlation with the cry1 gene, the only cryptochrome gene with the daily rhythmicity in Chinese perch fast muscle. Of the period and cry genes with the daily rhythmic expression in Chinese perch slow muscles, per1/2 showed the positive correlation with both cry1 and cry3. These results suggested that per may interact with cry to control the transcriptional activation and function in the circadian feedback loop.

Nr1d1, nr1d2 and rorα are members of nuclear receptor family, which are involved in stabilizing the circadian clock loop [20, 3840]. Nr1d1 and nr1d2 were identified as the constitutive transcriptional repressors of arntl1, whereas rorα is the arntl1 transcriptional activator [2, 41]. In addition, nr1d1 was considered to be interwoven into the core clock mechanism via downregulating the clock expression. As reported in mammals, Npas2 expression was repressed by these nuclear receptors [40, 42]. In this study, the three nuclear receptors displayed a daily rhythmic expression in Chinese perch fast muscles and nr1d2 exhibited a negative correlation with the expression of rorα gene. This is reflected in their tight regulation with the circadian mechanism. Nr1d2 also showed a negative correlation with clock and npas2. Therefore, it is possible that nrld2 may function by repressing npas2 and clock expression in fast muscles. However, nr1d2 had no daily rhythmic expression in Chinese perch slow muscles and nr1d1 showed a direct relationship with the rorα expression. It could suggest that Chinese perch slow muscles may have a different circadian mechanism in maintaining the stabilization loop.

In this study, the transcription levels of eleven genes related to myogenesis during the daily cycle were investigated. The data revealed that seven genes had a daily rhythmic expression in fast muscles and five in slow muscles. Myogenic regulatory factors(MRFs) (such as myoD, myf5, mrf4 and myoG), belong to the same class of helix-loop-helix transcription factors that play distinct and overlapping roles in regulating muscle development and growth [43, 44]. It has been reported that the circadian regulation of myoD expression by lock/arntl was crucial for the skeletal muscle phenotype and function in mouse [32]. Our study confirmed that myoD in Chinese perch fast muscles exhibited a typical daily rhythmicity. Based on our observation, it is possible that the circadian regulation of Chinese perch myoD may function in a similar way as reported in mouse. In contrast, we have not obtained any direct evidence for circadian expression of myoD in Chinese perch slow muscles. Therefore, it is possible that the differentially expressed MRFs may result from the lineage-specific differences by clock genes. However, our work demonstrated that one of the MRFs, mrf4, in Chinese perch slow muscles exhibited a rhythmic expression pattern similar to that described for myoD in fast muscles, suggesting that mrf4 may have a potential function in the maintenance of muscle phenotype and function.

Conclusion

In this study, we assayed the possible correlation of a functional clock system in Chinese perch slow and fast skeletal muscles. We demonstrated that 10 clock genes and 7 genes related to myogenesis exhibited the daily rhythmicity in fast muscles of Chinese perch. The 11 clock genes and 5 genes related to myogenesis have the daily rhythmicity in slow muscles (Fig. 7). The circadian expression of mrf4, myf5, mstn, and pcna may either positively or negatively regulate the transcription of the clock genes in both types of muscles. It is plausible that muscle type-specific maintenance and function is regulated by the core clock genes. This is based on the evidence of daily rhythmicity and apparent correlation of gene expression of clock genes and genes related to myogenesis. Taken together, our data provide new information on the rhythmic expression of clock genes and a better understanding of the circadian clocks in fish muscle phenotype maintaining and function.
Fig. 7
Fig. 7

Molecular components of the clock system identified in fast and slow skeletal muscles of Chinese Perch and myogenic genes with daily rhythmic expression. The green and red oval represent genes involved in the peripheral clock components in Chinese Perch skeletal muscles, which is related with the muscle fiber. They comprise members of the transcriptional activator arm (in red: arntl1, arntl2, clock and npas2), transcriptional repressor arm (in green: cry1, cry2, cry3, cry-dash, per1, per2, per3 and tim) and nuclei (in nucleus: nr1d1, nr1d2 and rorα). The daily rhythmicity of mbnl1, mrf4, mstn, myf5, myoD, myoG and pcna play a crucial role in fast muscle specification, and foxk2, mrf4, mstn, myf5 and pcna play an important role in terminal slow muscle differentiation

Methods

Daily rhythm experiment

Adult Chinese perch (body weight 450 ± 10 g) were stocked in 250 m3 tanks. Fifteen testing fishes were kept in each tank and a total of six tanks were used in the experiment. To liminate the fish disturbance during sampling, the fish were fed at the same time each day. During the experiment, water temperature was kept at 25 ± 0.8 °C, dissolved oxygen at 85 ± 2% and the light intensity of the water surface at 0.84 W*m−2 (200 lx). The testing fishes were acclimated to the above described conditions for 2 weeks during a daily light–dark cycle before sample collection. Six individuals were randomly collected from the each tank in every three hours until 24 h (Zeitgeber time: ZT0, 3, 6, 9, 12, 15, 18, 21 and 24). Sampling of the light treatment at the different time points was basically followed as described by Lazada [2]. Briefly, samples at ZT0 were collected when the light reached to a maximum intensity, the samples at ZT24 were collected when it transited to the light phase; The ZT12 samples were collected at approximately 20 min later, while samples of ZT0-9 and ZT15-24 were collected at the time between the light and dark. The fast muscle was sampled from the dorsal muscle tissue, and slow muscle was collected under the body skin [16]. All of the collected muscle samples were washed with cold and sterilized 1 × PBS to remove contaminating blood and then immediately stored in liquid nitrogen at −80 °C for total RNA extraction.

Molecular cloning of Chinese perch clock genes

To amplify the cDNA fragments of the clock genes, the primers were designed based on the assembled EST sequences of the Chinese perch muscle database (accession nos: SRX1738860) or the clock gene sequences from several-related fish species (Table 1). The full length cDNAs of the four clock genes were amplified with the SMART RACE cDNA Amplification Kit according to the manufacture’s instruction (Clontech, Palo Alto, CA, USA). Specific nested PCR primers were designed based on the cloned partial sequences (Table 1). For 5′ RACE amplification, the protocols were conducted as follows: 35 cycles of 94 °C for 30 s, 60 °C for 30 s and 72 °C for 1 min. For 3′-RACE, two amplifications were conducted at the same parameters as 5′ RACE the amplification described above.

Bioinformatic analysis of the clock genes

The cDNA fragment identity was confirmed with BLAST (http://blast.ncbi.nlm.nih.gov) and the deduced amino acid sequences were obtained using the ExPASy Proteomics Server (http://www.expasy.ch). The complete amino acid sequences of the clock, cry1, per1 and nr1d2 domains were analyzed through UniProt (http://www.uniprot.org) and the ExPASy proteomics Server (http://www.expasy.ch). The clock gene sequences of other teleosts were obtained from the NCBI databases and the protein accession numbers are listed in Additional file 2.

Gene expression analysis

Total RNAs were isolated from Chinese perch muscles using the TRIzolR Reagent (Invitrogen, USA). The RNA samples were treated with RNAse-free DNAse I (Promega, USA) in the presence of RNAse inhibitor (Sigma, China Branch), and then precipitated with ethanol. The obtained RNA was reversely transcribed with Super-Script III RNase H-Reverse Transcriptase (Invitrogen, USA) following the manufacturer’s instruction. For a negative control, no cDNA sample was added in the PCR reaction.

Primers for the qRT-PCR assays were designed using the software Primer 5.0 (Table 7). The reverse transcribed cDNAs from skeletal muscles were used as templates for qRT-PCR assays with SYBR Green PCR reaction kit (Stratagene, Shanghai, China). The qRT-PCR amplification reaction was carried out using the Stratagene Mx3005 system (Stratagene, CA, USA). A total volume of 25 μL reaction was used for the qRT-PCR assays, containing 1 μL cDNA templates, 12.5 μL SYBR Green mix, and 1 μmol/L each of forward and reverse primers. The reaction protocol was used as the standard cycling of the qPCR. Each product identity was verified by dideoxy-mediated chain termination sequencing at Sangon Biotechnology Inc. (Shanghai, China). The relative expression ratio (R) of target mRNA was calculated by R = 2-ΔΔCt [45, 46], where Ct is the cycle threshold. The basic equation employed was ΔΔCt = (Ct target gene − Ct housekeeping gene) experiment − (Ct target gene − Ct housekeeping gene) control. The treanscriptional levels of selected muscle-related genes in Chinese perch fast and slow muscles during a daily cycle were also quantitatively assayed using the same qRT-PCR protocol.
Table 7

Primers used for genes cloning and quantitative real-time PCR

Primer name

Sequence (5′-3′)

Items

3’-RACE outer

R:CTGATCTAGAGGTACCGGATCC

3’-RACE

Clock 3’-RACE inner

F:AGACGGCTGTAGTGGCTC

3’-RACE

Clock 3’-RACE inner

F:AGACGGCTGTAGTGGCTC

3’-RACE

5’-RACE outer

F:GACTCGAGTCGACATCG

5’-RACE

Cry1 5’-RACE inner

R: TTGGCATTCATTCTGGGACG

5’-RACE

Cry1 5’-RACE inner

R: GGTCTGGAACCGTTTGTAGG

5’-RACE

Cry1 3’-RACE inner

F: TCAAGGAGACTGGCAAAGCG

3’-RACE

Cry1 3’-RACE inner

F: CCACAAGCCAGCATCAGCAC

3’-RACE

Per1 5’-RACE inner

R: ATTTAGAGTGCTGGCGTGGC

5’-RACE

Per1 5’-RACE inner

R: GGGCGAACCTTCAGATCCTG

5’-RACE

Per1 3’-RACE inner

F: GAGAACGGTGAAACAAATGA

3’-RACE

Per1 3’-RACE inner

F: ACGCTTCACCGAGGAACAGA

3’-RACE

Nr1d2 5’-RACE inner

R: CAGTCTGAAGGGGCAGTGGT

5’-RACE

Nr1d2 5’-RACE inner

R: GACTGGTAGCTGCCGTTGGA

5’-RACE

Nr1d2 3’-RACE inner

F: AGTGCCGCTTCAAGAAATGC

3’-RACE

Nr1d2 3’-RACE inner

F: GGAGATGAGCCTCTTCACTGC

3’-RACE

Arntl1

F: GGCTATCCCTACTCCAACCAG

RT-PCR

Arntl2

R: TTGCTGGGGCTGCTGGAA

RT-PCR

F: AGGGACCCAAATCGCAAATG

Clock

R: TGTGGGGAAACAAGGGGAC

RT-PCR

F: TGCTGGAGGCTCTGGATGG

Npas2

R: GGTTCTGGTCCACTAAGTCCGTC

RT-PCR

F: CAGATAGCGAGTTCAGCCAAGA

Cry1

R: TGGAGAATGAAGGAGCGATGA

RT-PCR

F: GAATGCCAACTCACTGCTCG

Cry2

R: CGAAGCAGGGGTTGTTGG

RT-PCR

F: GAGAAAAGCGTGGGTGGC

Cry3

R: CTTGCGGTAGAGGTCTGTGAG

RT-PCR

F: ATCTTGAAGGACTACCCGAACC

Cry-dash

R: GCTGCCCTCTGCGTGGTTA

RT-PCR

F: GCCCTGGACCCTCAGCACT

Per1

R: CCTCTATCCCGATGTTGTTTGG

RT-PCR

F: CAACAAACTCATCCTCCTGGC

Per2

R: CGGTGGGTAAACAGGGTAGATT

RT-PCR

F: TGGTAACGAGTCGCAAGGC

Per3

R: TCACCAGACTGAAGGCGTTAGA

RT-PCR

F: CAAAGCCGAGTGAAGGACAG

Nr1d1

R: GGGTTATCGCTCTGGTTGG

RT-PCR

F: GCCGTGGTGCTGGTGTCTG

Nr1d2

R: TTGTTGAGCGTTCGCAGGTC

RT-PCR

F:TCTCCCCATGTGGACCCTC

Rorα

R: GGTGCGGTCCTTCACATCG

RT-PCR

F: GGTGGGTTCTACCTGGACTTCC

Tim

R: TGAAGGAGCAGTACGGGAAGAA

RT-PCR

F: GAAGGCTACAGCAAAGACGGA

Foxk2

R:CTGGCACTTCAGAATGACGGT

RT-PCR

F: CCTGAGGTGTCTCGGCAAAA

Mbnl1

R: TGAGCGATGTTGTCTGGAATG

RT-PCR

F: AGGTGGACAACGGACGGG

Mrf4

R: CTTTAGGTGGGGAGGAGGGT

RT-PCR

F: CCGACCTCTGCTGACCATTC

Mstn

R: GACGCAGAAGACTCACTGGTTT

RT-PCR

F:GCACATACGCATCCGCTCCCT

Murf1

R:GTCACGGCCAAGTCATTTCCA

RT-PCR

F: TCCAGGAACCCCTACCACTACT

Myf5

R: CACTTCGGCTCTTTGGTGTCTT

RT-PCR

F:AGGTCAACCACGCTTTCGAG

myoD

R:GTTTTCCACCTGCTCCCGTA

RT-PCR

F:CAACGACGCCTTTGAGACCCTG

myoG

R:GTCCGAATCCCCGCTGTAGTGT

RT-PCR

F: GGTGTTGGAGTCGGGGTGA

Pdk4

R: TGGTAACCGTCTTCCTTTTGC

RT-PCR

F: CTCTGGTGAACATCCGTAATCG

Pcna

R:ATGGGCTGGGTTCACGCT

RT-PCR

F: GGACGAGGCGGTCACTATTG

Ucp3

R: CTGAGGGTGACGGTCTTGGA

RT-PCR

F: GTATCGGGGAGCGTTTGG

Rpl-13

R: AGTCCTGCCACCAGTCCGT

internal reference

F:CACAAGAAGGAGAAGGCTCGGGT

β-actin

R: TTTGGCTCTCTTGGCACGGAT

internal reference

F:TGCGTGACATCAAGGAGAAGC

 

R:GAGGAAGGAAGGCTGGAAGAG

 

hprt1

F:CATACCAAAGCATTACGCAGAAG

internal reference

R:CACCTCGAATCCTACAAAGTCCG

 

rps29

F:TCACCCCAGAAAATTCGGACAGG

internal reference

R:GTATTTACGGATCAGACCGTGTC

 

GAPDH

F:ATCAAGGAAGCGGTGAAGAAGG

internal reference

R:CGAAGATGGAGGAGTGGGTGTC

 

18 S rRNA

F:GGAATGAGCGTATCCTAAACCC

internal reference

R:CTCCCGAGATCCAACTACAAGC

 

The stability of transcription of reference genes was assayed with GeNorm system and total six reference genes were analyzed including Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), β-actin, 18 S rRNA gene, hypoxanthine phosphoribosyltransferase 1-like (hprt1), epinephelus coioides ribosomal protein S29 (rps29) and ribosomal protein L13 (rpl13) [4749]. GeNorm analysis revealed that rpl13 was the most stable control gene in skeletal muscles (geNorm stability value M = 0.28). The geometric average of these genes were measured by absolute quantification within all samples then calculated by one-way ANOVA procedures and gene expression values are displayed as arbitrary units.

Statistical analysis

The transcriptional expression levels of the clock and muscle-related genes at each time points were analyzed with the Sigma plot and then were calculated by one-way ANOVA procedures using SPSS software. To compare the difference between the control and experimental groups, Duncan’s multiple range tests were used for the analysis. The differences were considered to be statistically significant when the P value was less than 0.05. Data are shown as means ± SE (n = 6).

The daily rhythmicity in relation to the expression of the clock and muscle-related genes was assayed with Matlab 7.0 followed as described by earlier studies [2, 37]. To perform a COSINOR analysis, the formula ƒ(t) = M + Acos(t/pi/12 –φ) was used, where ƒ(t) stands for the gene expression level at a given time, mesor (M) stands for the mean value, A stands for is the oscillation amplitude, t is the time in hours and φ stands for the acrophase. The P value was defined by the noise/signal of the amplitude (SE(A)/A) and if P Value <0.3, the expression levels could considered to display daily rhythmicity [2, 37]. Correlation between the clock and muscle-related gene expression was assayed with Pearson’s correlation test (r).

Abbreviations

bHLH: 

Basic-helix-loop-helix

FAD: 

Flavin adenine dinucleotide

GAPDH: 

Glyceraldehyde-3-phosphate dehydrogenase

L. crocea

Larimichthys crocea

MFMR: 

Multifunctional mosaic region

MRFs: 

Myogenic regulatory factors

MS-222: 

Tricaine methanesulfonate

ORF: 

Open reading frame

PAS: 

Per-Arnt-Ser

UTR: 

Untranslated regions

ZT: 

Zeitgeber time

Declarations

Acknowledgments

We thank Dr. Shaojun Du from University of Maryland USA for proofreading and instruction during the manuscript preparation and The Collaborative Innovation Center for Efficient and Health Production of Fisheries, Hunan Province for supporting and assistance with the fish.

Funding

W.Y.C. is funded by the Nature and Science Foundation of China for the skeletal muscle gene cloning and expression analysis (No. 31472256); J.S.Z is also funded by the Nature and Science Foundation of China for the skeletal muscle gene and function analysis (no 31230076 and No.31572592); J.C is funded by the Nature and Science Foundation of China for the clock gene identification (no 31502149). The funding bodies did not have a role in the design of the study, data collection, analysis, interpretation of data, writing the manuscript, nor the decision to publish.

Availability of data and materials

Chinese perch clock gene sequences were deposited in NCBI database, their accession numbers and all other related data are all listed in Additional file 1.

Authors’ contributions

WYC and JSZ conceived and designed the study and wrote the paper; PW performed the experiments including RNA extraction, cDNA synthesis, and bioinformatics analysis; YLL, XZ and FZG worked for fish husbandry, sample collecting and bioinformatics analysis; JC and LC were responsible for gene rhythmic expression analysis. All authors were involved in preparing and writing the manuscript and approved the final version.

Competing interests

The authors declare that they have no competing interests.

Consent for publication

Not applicable.

Ethics approval and consent to participate

The protocol was approved by the Institutional Animal Care and Use Committee (IACUC) of Changsha University (permit #20128945-1). All surgeries were performed under sodium pentobarbital or tricaine methanesulfonate (MS-222) anesthesia, and every effort was made to minimize the animal suffering. All fish-handling procedures during the studies were approved by the IACUC Committee.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Bioengineering and Environmental Science, Changsha University, Changsha, Hunan, 410003, China
(2)
Collaborative Innovation Center for Efficient and Health Production of Fisheries in Hunan Province, Changde, 415000, China
(3)
College of Life Sciences, Xinyang Normal University, Xinyang, Henan, 464000, China

References

  1. Wenger CB. The regulation of body temperature. In: Rhoades RA, Tanner GA, editors. Medical Physiology. New York: Little, Brown; 1995: 587-613Google Scholar
  2. Lazado CC, Kumaratunga HP, Nagasawa K, Babiak I, Giannetto A, Fernandes JM. Daily rhythmicity of clock gene transcripts in Atlantic cod fast skeletal muscle. PLoS One. 2014;9(6):e99172.View ArticlePubMedPubMed CentralGoogle Scholar
  3. Kojima S, Shingle DL, Green CB. Post-transcriptional control of circadian rhythms. J Cell Sci. 2011;124(3):311–20.View ArticlePubMedPubMed CentralGoogle Scholar
  4. Lowrey PL, Takahashi JS. Mammalian circadian biology: elucidating genome-wide levels of temporal organization. Annu Rev Genomics Hum Genet. 2004;5:407.View ArticlePubMedPubMed CentralGoogle Scholar
  5. Ueda HR, Hayashi S, Chen W, Sano M, Machida M, Shigeyoshi Y, Iino M, Hashimoto S. System-level identification of transcriptional circuits underlying mammalian circadian clocks. Nat Genet. 2005;37(2):187–92.View ArticlePubMedGoogle Scholar
  6. Ptitsyn AA, Zvonic S, Conrad SA, Scott LK, Mynatt RL, Gimble JM. Circadian clocks are resounding in peripheral tissues. PLoS Comput Biol. 2006;2(3):e16.View ArticlePubMedPubMed CentralGoogle Scholar
  7. Hogenesch JB, Gu YZ, Jain S, Bradfield CA. The basic-helix–loop–helix-PAS orphan MOP3 forms transcriptionally active complexes with circadian and hypoxia factors. Proc Natl Acad Sci. 1998;95(10):5474–9.View ArticlePubMedPubMed CentralGoogle Scholar
  8. Froy O. Metabolism and circadian rhythms—implications for obesity. Endocr Rev. 2010;31(1):1–24.View ArticlePubMedGoogle Scholar
  9. Braun T, Gautel M. Transcriptional mechanisms regulating skeletal muscle differentiation, growth and homeostasis. Nat Rev Mol Cell Biol. 2011;12(6):349–61.View ArticlePubMedGoogle Scholar
  10. McCarthy JJ, Andrews JL, McDearmon EL, Campbell KS, Barber BK, Miller BH, Walker JR, Hogenesch JB, Takahashi JS, Esser KA. Identification of the circadian transcriptome in adult mouse skeletal muscle. Physiol Genomics. 2007;31(1):86–95.View ArticlePubMedGoogle Scholar
  11. Ahammad AS, Asaduzzaman M, Asakawa S, Watabe S, Kinoshita S. Regulation of gene expression mediating indeterminate muscle growth in teleosts. Mech Dev. 2015;137:53–65.View ArticlePubMedGoogle Scholar
  12. Thompson A, Vo D, Comfort C, Zakon HH. Expression evolution facilitated the convergent neofunctionalization of a sodium channel gene. Mol Biol Evol. 2014;31(8):1941–55.View ArticlePubMedPubMed CentralGoogle Scholar
  13. Johnston I, Camm J-P. Muscle structure and differentiation in pelagic and demersal stages of the Antarctic teleost Notothenia neglecta. Mar Biol. 1987;94(2):183–90.View ArticleGoogle Scholar
  14. Van Raamsdonk W, Pool C, de Kronnie G. Differentiation of muscle fiber types in the teleost Brachydanio rerio. Anat Embryol. 1978;153(2):137–55.View ArticlePubMedGoogle Scholar
  15. Barton-Davis ER, Shoturma DI, Musaro A, Rosenthal N, Sweeney HL. Viral mediated expression of insulin-like growth factor I blocks the aging-related loss of skeletal muscle function. Proc Natl Acad Sci. 1998;95(26):15603–7.View ArticlePubMedPubMed CentralGoogle Scholar
  16. Bone Q. On the function of the two types of myotomal muscle fibre in elasmobranch fish. J Mar Biol Ass UK. 1966;46(32):1–349.Google Scholar
  17. Lin J, Wu H, Tarr PT, Zhang C-Y, Wu Z, Boss O, Michael LF, Puigserver P, Isotani E, Olson EN. Transcriptional co-activator PGC-1α drives the formation of slow-twitch muscle fibres. Nature. 2002;418(6899):797–801.View ArticlePubMedGoogle Scholar
  18. De Almeida-Val VMF, Gomes AC, Lopes NP. Metabolic and physiological adjustments to low oxygen and high temperature in fishes of the Amazon. Fish Physiol. 2005;21:443–500.View ArticleGoogle Scholar
  19. Whitmore D, Foulkes NS, Strähle U, Sassone-Corsi P. Zebrafish Clock rhythmic expression reveals independent peripheral circadian oscillators. Nat Neurosci. 1998;1(8):701–7.View ArticlePubMedGoogle Scholar
  20. Amaral IP, Johnston IA. Circadian expression of clock and putative clock-controlled genes in skeletal muscle of the zebrafish. Am J Physiol Regul Integr Comp Physiol. 2012;302(1):R193–206.View ArticlePubMedGoogle Scholar
  21. Amaral IP, Johnston IA. Experimental selection for body size at age modifies early life-history traits and muscle gene expression in adult zebrafish. J Exp Biol. 2012;215(22):3895–904.View ArticlePubMedGoogle Scholar
  22. Chu WY, Liu LS, Li YL, Chen L, Wang KZ, Li HH, Du SJ, Zhang JS. Systematic identification and differential expression profiling of microRNAs from white and red muscles of Siniperca chuatsi. Curr Mol Med. 2013;13(8):1397–407.View ArticlePubMedGoogle Scholar
  23. Tang D, Andrews M, Cobcroft JM. The first chondracanthid (Copepoda: Cyclopoida) reported from cultured finfish, with a revised key to the species of Chondracanthus. J Parasitol. 2007;93(4):788–95.View ArticlePubMedGoogle Scholar
  24. Martín-Robles ÁJ, Whitmore D, Sánchez-Vázquez FJ, Pendón C, Muñoz-Cueto JA. Cloning, tissue expression pattern and daily rhythms of Period1, Period2, and Clock transcripts in the flatfish Senegalese sole, Solea senegalensis. J Comp Physiol B. 2012;182(5):673–85.View ArticlePubMedGoogle Scholar
  25. Hirayama J, Sassone-Corsi P. Structural and functional features of transcription factors controlling the circadian clock. Curr Opin Genet Dev. 2005;15(5):548–56.View ArticlePubMedGoogle Scholar
  26. Öztürk N, Song S-H, Özgür S, Selby C, Morrison L, Partch C, Zhong D, Sancar A. Structure and function of animal cryptochromes. In: Cold Spring Harbor Symposia on Quantitative Biology: 2007. New York; Cold Spring Harbor Laboratory Press. 2007. p. 119–31.Google Scholar
  27. Busza A, Emery-Le M, Rosbash M, Emery P. Roles of the two Drosophila CRYPTOCHROME structural domains in circadian photoreception. Science. 2004;304(5676):1503–6.View ArticlePubMedGoogle Scholar
  28. del Pozo A, Vera LM, Sánchez JA, Sánchez-Vázquez FJ. Molecular cloning, tissue distribution and daily expression of cry1 and cry2 clock genes in European seabass (Dicentrarchus labrax). Comp Biochem Physiol A Mol Integr Physiol. 2012;163(3):364–71.View ArticlePubMedGoogle Scholar
  29. Brudler R, Hitomi K, Daiyasu H, Toh H, Kucho K-i, Ishiura M, Kanehisa M, Roberts VA, Todo T, Tainer JA. Identification of a new cryptochrome class: structure, function, and evolution. Mol Cell. 2003;11(1):59–67.View ArticlePubMedGoogle Scholar
  30. Zhang EE, Liu AC, Hirota T, Miraglia LJ, Welch G, Pongsawakul PY, Liu X, Atwood A, Huss JW, Janes J. A genome-wide RNAi screen for modifiers of the circadian clock in human cells. Cell. 2009;139(1):199–210.View ArticlePubMedPubMed CentralGoogle Scholar
  31. Cheng H-YM, Papp JW, Varlamova O, Dziema H, Russell B, Curfman JP, Nakazawa T, Shimizu K, Okamura H, Impey S. microRNA modulation of circadian-clock period and entrainment. Neuron. 2007;54(5):813–29.View ArticlePubMedPubMed CentralGoogle Scholar
  32. Andrews JL, Zhang X, McCarthy JJ, McDearmon EL, Hornberger TA, Russell B, Campbell KS, Arbogast S, Reid MB, Walker JR. CLOCK and BMAL1 regulate MyoD and are necessary for maintenance of skeletal muscle phenotype and function. Proc Natl Acad Sci. 2010;107(44):19090–5.View ArticlePubMedPubMed CentralGoogle Scholar
  33. Lazado CC, Nagasawa K, Babiak I, Kumaratunga HP, Fernandes JM. Circadian rhythmicity and photic plasticity of myosin gene transcription in fast skeletal muscle of Atlantic cod (Gadus morhua). Mar genomics. 2014;18:21–9.View ArticlePubMedGoogle Scholar
  34. Patiño MAL, Rodríguez-Illamola A, Conde-Sieira M, Soengas JL, Míguez JM. Daily rhythmic expression patterns of clock1a, bmal1, and per1 genes in retina and hypothalamus of the rainbow trout, Oncorhynchus mykiss. Chronobiol Int. 2011;28(5):381–9.View ArticlePubMedGoogle Scholar
  35. Davie A, Sanchez JA, Vera LM, Sanchez-Vazquez J, Migaud H. Ontogeny of the circadian system during embryogenesis in rainbow trout (Oncorhynchus mykyss) and the effect of prolonged exposure to continuous illumination on daily rhythms of per1, clock, and aanat2 expression. Chronobiol Int. 2011;28(3):177–86.View ArticlePubMedGoogle Scholar
  36. McStay E, Migaud H, Vera LM, Sánchez-Vázquez FJ, Davie A. Comparative study of pineal clock gene and AANAT2 expression in relation to melatonin synthesis in Atlantic salmon (Salmo salar) and European seabass (Dicentrarchus labrax). Comp Biochem Physiol A Mol Integr Physiol. 2014;169:77–89.View ArticlePubMedGoogle Scholar
  37. Velarde E, Haque R, Iuvone P, Azpeleta C, Alonso-Gómez A, Delgado M. Circadian clock genes of goldfish, Carassius auratus: cDNA cloning and rhythmic expression of period and cryptochrome transcripts in retina, liver, and gut. J Biol Rhythms. 2009;24(2):104–13.View ArticlePubMedPubMed CentralGoogle Scholar
  38. Vatine G, Vallone D, Gothilf Y, Foulkes NS. It’s time to swim! Zebrafish and the circadian clock. Febs Letters. 2011;585(10):1485–94.View ArticlePubMedGoogle Scholar
  39. Emery P, Reppert SM. A rhythmic Ror. Neuron. 2004;43(4):443–6.View ArticlePubMedGoogle Scholar
  40. Raghuram S, Stayrook KR, Huang P, Rogers PM, Nosie AK, McClure DB, Burris LL, Khorasanizadeh S, Burris TP, Rastinejad F. Identification of heme as the ligand for the orphan nuclear receptors REV-ERBα and REV-ERBβ. Nat Struct Mol Biol. 2007;14(12):1207–13.View ArticlePubMedPubMed CentralGoogle Scholar
  41. Mazzoccoli G, Tomanin R, Mazza T, D’Avanzo F, Salvalaio M, Rigon L, Zanetti A, Pazienza V, Francavilla M, Giuliani F. Circadian transcriptome analysis in human fibroblasts from Hunter syndrome and impact of iduronate-2-sulfatase treatment. BMC Med Genomics. 2013;6(1):37.View ArticlePubMedPubMed CentralGoogle Scholar
  42. Baggs JE, Price TS, DiTacchio L, Panda S, FitzGerald GA, Hogenesch JB. Network features of the mammalian circadian clock. PLoS Biol. 2009;7(3):563.View ArticleGoogle Scholar
  43. Naidu PS, Ludolph DC, To RQ, Hinterberger TJ, Konieczny SF. Myogenin and MEF2 function synergistically to activate the MRF4 promoter during myogenesis. Mol Cell Biol. 1995;15(5):2707–18.View ArticlePubMedPubMed CentralGoogle Scholar
  44. Chong S-W, Nguyet L-M, Jiang Y-J, Korzh V. The chemokine Sdf-1 and its receptor Cxcr4 are required for formation of muscle in zebrafish. BMC Dev Biol. 2007;7(1):54.View ArticlePubMedPubMed CentralGoogle Scholar
  45. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 2009;55(4):611–22.View ArticlePubMedGoogle Scholar
  46. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods. 2001;25(4):402–8.View ArticlePubMedGoogle Scholar
  47. Zhou RX, Meng T, Meng HB, Cheng DX, Bin SY, Cheng J, Fu GH, Chu WY, Zhang JS. Selection of reference genes in transcription analysis of gene expression of the Mandarin fish, Siniperca chuasti. Dongwuxue Yanjiu. 2010;31(2):141–6.PubMedGoogle Scholar
  48. Liu J, Wang Q, Sun M, Zhu L, Yang M, Zhao Y. Selection of reference genes for quantitative real-time PCR normalization in panax ginseng at different stages of growth and in different organs. PLoS One. 2014;9(11):e112117.View ArticleGoogle Scholar
  49. Sun JH, Nan LH, Gao CR, Wang YY. Validation of reference genes for estimating wound age in contused rat skeletal muscle by quantitative real-time PCR. Int J Leg Med. 2012;126(1):113–20.View ArticleGoogle Scholar

Copyright

© The Author(s). 2016

Advertisement