Skip to content

Advertisement

  • Research article
  • Open Access

Genetic variants in the SIRT6 transcriptional regulatory region affect gene activity and carcass quality traits in indigenous Chinese beef cattle (Bos taurus)

†Contributed equally
BMC Genomics201819:785

https://doi.org/10.1186/s12864-018-5149-0

©  The Author(s). 2018

  • Received: 21 May 2018
  • Accepted: 8 October 2018
  • Published:

Abstract

Background

The aim of this study was to analyze potential influences of polymorphisms within the regulatory region of the bovine SIRT6 gene on carcass quality traits. Expression analyses suggested that SIRT6 gene is predominately expressed in kidney, compared with other tissues. In 535 indigenous Chinese beef cattle, two novel single nucleotide polymorphisms (SNPs) were identified within the promoter region of the SIRT6 gene.

Results

Association analysis indicated that G allele of the c.-1100 A > G had a positive effect on fat deposition, and the Hap4/4 diplotype had more favourable results than other dipoltypes with respect to the evaluation of carcass quality traits. Furthermore, promoter activity associated with the Hap3 haplotype was measured at higher levels than the Hap1 haplotype, which would be in agreement with the previously described association analysis.

Conclusion

The SIRT6 promoter variants significantly affect transcriptional levels and subsequently significantly influence bovine intramscular fat content.

Keywords

  • Transcription factor
  • SIRT6
  • Fat deposition
  • Expression pattern

Background

SIR2 and its homologs, termed sirtuins, are members of the class III nicotinamide adenine dinucleotide-dependent deacetylase family [1]. Seven homologues of SIR2, have been designated as SIRT1–7 with various cellular localization and carboxyl termini in mammals [2]. Among the sirtuins, Sirt6, mainly a protein associated with nuclear chromatin, has distinct roles in metabolism, stress resistance and lifespan [3].

Previous studies demonstrated that SIRT6 gene could deacetylate histone H3K9, and modulate the expression level of associated metabolic genes [4]. More specifically, SIRT6 knockdown cells promoted glycolysis via improved activity of Hif1α [5]. The expressions of genes consisted of lipid and glycolysis metabolism were modified by the knockdown of SIRT6 in liver. This was associated with striking phenotypes, including under-size and delayed bone mineralization [6]. Similarly, mice with neural-specific deletion of SIRT6 exhibited somatotropic attenuation associated with reduced growth hormone (GH) levels [7]. In addtion, SIRT6 gene controls cholesterol homeostasis of mice, and negatively regulates lipogenic transcription factors (i.e., SREBP1 and SREBP2) via promoting their phosphorylation [8]. In response to fasting, transgenic mice overexpressing SIRT6 gene attenuated excess fat deposition due to the reduction of PPARγ gene [9]. These results revealed that SIRT6 gene acted as a critical enzyme for the maintaining of lipid metabolism, which may be closely related to fat deposition in mammals.

Through modifying transcription factor binding sites, sequence variation within promoter and other regulatory regions of gene may impact expression level, and influence phenotypes [10]. Previously, four SNPs were identified within the bovine SIRT6 gene, and correlated with carcass quality traits [11]. However, functional mutations within the promoter region of bovine SIRT6 have not been reported. The current study was aimed at analyzing the relationship between promoter polyorphisms and fat deposition in Chinese indigenous cattle.

Methods

Ethics approval

All animal experiments were conducted according to the guidelines established by the regulations this work was performed at a farm in the Department of Animal Sciences and Technology at Qinghai University, China. Ethical approval for this study was obtained from the Ethical Committee of Qinghai University. The procedures were approved by the Ethical Committee of China Animal Care Qinghai University.

Ontogenic expression

As is shown in Fig. 1, 13 tissues and organs were collected from three purebred bulls of 2 years old of the Qinchuan cattle. Total RNA were performed to reverse transcription using the PrimeSriptTM RT reagent kit (TaKaRa, Dalian, China) based on its recommended procedure.
Fig. 1
Fig. 1

Tissue expression analysis of Qinchuan cattle SIRT6 mRNA

In this study, two housekeeping genes were used: β-actin (AY141970.1) and GAPDH (NM_001034034). The qPCR was conducted by the Applied Biosystems 7500 Fast Real-Time PCR System (Applied Biosystems, USA) with the SYBR® Premix Ex TaqTM kit (TaKaRa, Dalian, China). The oligonucleotide primers used for the qPCR were designed with Primer Premier 5.0 software (Table 1). The relative results were computed with the 2-△△Ct method [12].
Table 1

Primers used in this study

Name

Function

Primer Sequence (5′ to 3′)

Tm (°C)

Product Length

Amplified Region

SIRT6

qPCR

CAACCTGGAGAAATACCGTCTT

61.0

166 bp

400–565

CAGTCCTTTTTCCTTCAGCAG

β-actin

Reference

CACCAACTGGGACGACAT

61.0

202 bp

320–521

ATACAGGGACAGCACAGC

GAPDH

Reference

CCAACGTGTCTGTTGTGGAT

61.0

80 bp

778–857

CTGCTTCACCACCTTCTTGA

Primer A

SNP detection

GAGACGGCCAGGAAGGAC

62.7

320 bp

71 – − 249

CTGAACGAGGAAACAACG

Primer B

SNP detection

GACCCCTTCGTCCCCTCAAA

58.5

1367 bp

− 558 – − 1925

GGGTGGGAAGAGCCAGTAGC

Primer- c.-84 C > T

SNP genotyping

GAGGTAAGTGGGCGTCAG

60.5

357 bp

− 312 – 45

CACCAAAGGGAACAATAAAG

Primer- c.-1100 A > G

SNP genotyping

CCTCAGCTCCCTCCCTCCTAC

62.7

148 bp

− 1218 – − 1070

CATGATCAGGTGTCAGGGTTGAAT

Sample and data collection

Total 535 adult, female individuals between 18 and 24 months old, which were selected from Yangling Shaanxi Province, China. The blood samples were obtained from the jugular vein. Then genomic DNA was isolated from blood samples, stored at − 80 °C until subsequent analyses. Carcass quality traits (backfat thickness, ultrasound loin muscle area and intramuscular fat content) [13], were obtained from each individual.

Genotyping

As is presented in Table 1, the primers of bovine SIRT6 gene were designed according to the published gene sequence (AC_000164.1). Each PCR reaction was done in a 30 μL reaction mixture containing 50 ng of pooled genomic DNA, 10 pM of primer, 15 μL 2 × Reaction Mix, and 0.3 U Golden DNA polymerase (Tiangen Biotech, Beijing, China). The cycling protocol was performed according to the method of Gui et al. [11].

Two SNPs were detected in the promoter region of the SIRT6, named c.-84 C > T and c.-1100 A > G, respectively. Based on the sequence information, the ApaLI and AgsI restriction enzymes were utilized to digest PCR products for genotype. The electrophoresis on a 2.5% agarose gel was employed to identify the digested products, which were stained with ethidium bromide.

Luciferase activity assay

Previous methods were adopted to culture 3 T3-L1 cells [14]. A DNA fragment ranging from − 1224 to + 56 in the SIRT6 gene and encompassing the two polymorphic sites (-84C > T and -1100A > G) was amplified using a forward primer including a KpnI site (CGGGGTACC) and reverse primer including a BglII site (GGAAGATCT). Use of the dual-luciferase reporter assay standard procedure, the activity of firefly luciferase activity and Renilla luciferase were observed in 3 T3-L1 cells. All experiments were performed in triplicate and repeated twice.

Statistical analysis

Evaluation of linkage disequilibrium (LD) was conduted by the HAPLOVIEW software (Version 3.32). The general linear model was used for the evaluation of SNP-phenotype association. The equation was as follows: Yijk = u + Gi + Sj + Ak + eijk, where Yijk were the phenotypic observations; μ was the averaged values, Gi was the fixed effect of genotype, Sj was the random effect of sire, Ak was fixed effect of age, and eijk was the residual effect.

All values were presented as the mean ± SE. The difference between groups (gene expression levels of qPCR between tissues and relative luciferase activities between different constructs) was analyzed with the two-tailed t test.

Results

Expression profile

As shown in Fig. 1, bovine SIRT6 gene was ubiquitously expressed in various tissues and organs, with predominant expression level in the kidney, liver, muscle and subcutaneous fat. Whereas, SIRT6 gene had relatively low level in abomasum, reticulum, spleen, heart, lung, small and large intestine.

Single marker association analysis

Sequencing of PCR products from genomic DNAs revealed two polymorphisms within the SIRT6 promoter, named c.-84 C > T and c.-1100 A > G, respectively (Fig. 2). Based on the sequence information, the ApaLI and AgsI restriction enzymes were utilized to digest PCR products for genotype.
Fig. 2
Fig. 2

Transcriptional activity of the three haplotype constructs. The obtained data was determined relative to the activity of the empty pGL3 basic plasmid. The mean ± Std indicated the the mean values and standard deviations

As shown in Table 2, the backfat thickness and intramuscular fat content of individuals that inherited genotype -1100GG were significantly higher than those of individuals with the AA or GA genotype -1100AA (P < 0.05). Whereas, genotypes of the other SNP in the promoter region of SIRT6 had no significant correlation with fat deposition.
Table 2

Association of different genotypes of SNPs in the promoter region of SIRT6 with carcass quality traits in Qinchuan cattle

Locus

Genotypes (n)

Intramuscular fat content (%)

Ultrasound loin muscle area (cm)

Backfat thickness (cm2)

c.-84 C > T

CC (306)

7.197 ± 0.046

66.216 ± 1.776

1.024 ± 0.018

CT (196)

7.126 ± 0.058

64.801 ± 1.219

0.943 ± 0.023

TT (33)

7.212 ± 0.141

62.069 ± 2.209

0.942 ± 0.056

P-value

 

0.507

0.167

0.079

c.-1100 A > G

AA (250)

7.081 ± 0.054b

67.473 ± 1.962

0.956 ± 0.020b

AG (217)

7.148 ± 0.058ab

63.922 ± 2.106

0.970 ± 0.022b

GG (68)

7.494 ± 0.103a

62.824 ± 2.763

1.171 ± 0.038a

P-value

 

0.035

0.062

0.018

a,b Means with different superscripts are significantly different (P < 0.05)

Haplotype association analysis

The estimated values of D’ and r2 were used for the assessment of the relationship between the c.-84 C > T and c.-1100 A > G. The values of D’ and r2 were 0.147 and 0.021, respectively. Previous studies stated that, LD was strong enough when the r2 values were beyond 0.33 [15]. Therefore, the findings suggested that LD was weak between the two SNPs. It could be argued that recombination will exhibit the opposite trend in genovariation-dense regions.

Four haplotypes were detected and termed as Hap1 to 4 (Table 3). Among the estimated haplotype, frequencies of Hap1 (-CA-), Hap3 (−TG-), Hap4 (-CG-) and Hap2 (−TA-) were 64.50%, 22.00%, 11.00% and 2.50%, respectively. In this study, combinations with frequencies less than 5.0% were excluded for the lack of statistical significanc. As displayed in Table 4, there were higher intramuscular fat content and backfat thickness for individuals with the diplotypes Hap1/4 and Hap4/4 than those with diplotypes Hap1/1 and 1/3 (P < 0.05) in Qinchuan cattle. The results suggested that the diplotype Hap1/4 and Hap4/4 in fat deposition were prior to other combinations.
Table 3

Haplotypes and their frequencies in the SIRT6 gene for the SNPs

Haplotype

c.-84 C > T

c.-1100 A > G

Frequency

Hap1

C

A

0.645

Hap2

T

A

0.025

Hap3

T

G

0.220

Hap4

C

G

0.110

Table 4

Associations between the SIRT6 diplotypes and fat deposition in Qinchuan cattle

Diplotype (n)

Intramuscular fat content (%)

Ultrasound loin muscle area (cm)

Backfat thickness (cm2)

Hap1/1 (235)

7.122 ± 0.051b

67.732 ± 2.113a

0.967 ± 0.020b

Hap1/3 (183)

7.119 ± 0.058b

64.550 ± 2.394ab

0.937 ± 0.023b

Hap1/4 (31)

7.516 ± 0.140a

59.347 ± 3.816b

1.186 ± 0.055a

Hap4/4 (40)

7.487 ± 0.123a

62.636 ± 3.125ab

1.233 ± 0.049a

P value

0.012

0.029

0.036

Values with different superscripts within the same column differ significantly at P < 0.05 (a, b, c) and P < 0.01 (A, B, C)

Promoter assay

In this study, four haplotypes were cloned, and then luciferase reporter (named pGL3-Hap1 to 4) were constructed to analyze the effect of various haplotypes on the activity of transcription. Those plasmids were transfected in 3 T3-L1 cells and to detect the transcriptional activities. Figure 2 showed that Hap3 haplotype had higher activity than Hap1 haplotype (P < 0.05).

Discussion

The intramuscular fat, one of the four mammalian adipose tissue [16], was located in the epimysium, perimysium and endomysium, and was well correlated with sensory characteristics of beef [17, 18]. Thus, it is necessary to clarify the mechanisms of fat deposition for the improvement of intramuscular fat [19]. Emerging evidence suggested that the SIRT6 gene mainly located at nucleus functioned as deacetylation [9], mono-ADP ribosylation [20], depalmitoylation [21], and demyristoylation [22], thereby affecting both of energy and lipid metabolism in mammal. Hence, we inferred that the carcass quality traits could be mediated by SIRT6 gene in indigenous Chinese cattle .

The results of qPCR revealed that bovine SIRT6 gene mRNA was ubiquitously expressed, in agreement with the previous observations such as mice [19] and humans [23]. Especially, the expression level of SIRT6 gene in various tissues and organs verified that the high expression level of SIRT6 gene existed in liver, kidney, muscle and subcutaneous fat, but the slight expression level existed in lung. Except for muscle, the expression distribution of bovine SIRT6 gene reported here was similar to that seen in with mice [20]. Usually, gene expression levels might, at least in part, parallel well with its corresponding function in animals [24]. Therefore, the bovine SIRT6 was highly expressed in subcutaneous fat tissue. This result implied that this gene might be involved in lipornetabolism.

Nowadays, growing observations indicate that genetic variations in the promoter region can influence economical traits in livestock [25]. Both g.-85 G > T and g.-63 G > A in promoter region of the bovine SIX1 gene were significantly related to body measurements in Qinchuan cattle via modification of several binding sites for transcription factors [26]. The c.-1316 A > G mutation in KDR gene promoter region can increase the activity of transcription, consequently enhance intramuscular fat content in Erhualian pigs [27]. In the present study, two novel SNPs (c.-84 C > T and c.-1100 A > G) were detected in the SIRT6 gene promoter region. Correlation analysis showed significant correlation existed between c.-1100 A > G and fat deposition. The fat deposition of individuals that inherited genotype GG was significantly higher than that of individuals with genotype AA.

Previous studies indicated that mutations tended to occur in promoter regions [28], and impact the transcriptional activity [10]. Thus, we predicted the transcription binding factors corresponding to each SNP using the Genomatix software (ci value > 85). No differences existed in transcription factors at the c.-84 C > T locus, consistent with the results showing that genotypes of c.-84 C > T did not affect fat deposition in Qinchuan beef. The prediction suggested that, c. -1100 A and c. -1100 G could in sequence bind in three and four cis-acting elements (Table 5). These results suggested that the transcriptional activity of SIRT6 gene might be altered by the SNPs in the promoter region.
Table 5

The SNPs in the bovine SIRT6 that alter or are adjacent to the cis-acting elements

Locus

Genotype

Transcription factors

Cis-acting elements (Recognition sequencea)

Target strand

c.-84 C > T

C

Nuclear respiratory factor 1

cacggCGCAtgcgcctt

(+)

C

C2H2 zinc finger transcription factors 15

cacggcgcaTGCGcctt

(+)

C

Mouse Krueppel like factor

cacggcgcatgcgCCTTgcga

(+)

T

Nuclear respiratory factor 1

cacggCGCAtgcgcctt

(+)

T

C2H2 zinc finger transcription factors 15

cacggcgcaTGCGcctt

(+)

T

Mouse Krueppel like factor

cacggcgcatgcgCCTTgcga

(+)

c.-1100 A > G

A

NKX homeodomain factors

agggtTGAGtgctgggagc

(−)

A

Brachyury gene, mesoderm developmental factor

gagctgatcaGGTGtcagggttgagtgct

(−)

A

Calsenilin, presenilin binding protein, EF hand transcription factor

gtGTCAgggtt

(−)

G

Selenocysteine tRNA activating factor

tgcacccgcagcTCCCagcactcaaccc

(+)

G

NKX homeodomain factors

agggtTGAGtgctgggagc

(−)

G

Brachyury gene, mesoderm developmental factor

gagctgatcaGGTGtcagggttgagtgct

(−)

G

Calsenilin, presenilin binding protein, EF hand transcription factor

gtGTCAgggtt

(−)

aSNP loci in tables, capital letters are core sequence of the transcription factors, and the letters with ci value > 85 are underlined

Haplotypes comprised of unique SNP combinations had the potential to account for more variation than single marker selection for economically important traits [29]. Here, our results showed that the intramuscular fat content and backfat thickness of diplotypes Hap1/4 and Hap4/4 increased highly, compared with Hap1/1 and Hap1/3. Similar observations were found between Hap1/1 and Hap1/4 for ultrasound loin muscle area. Use of the TFSEARCH online database, the current study observed that these specific haplotypes had significant effect on two transcription factor combinations, and a separate assay (dual-luciferase reporter assay) reported transcriptional effects associated with these specific haplotypes. In particular, the activity of haplotype Hap1 was significantly lower compared with the haplotype Hap3; and the fat deposition of the diplotype Hap1/1 and Hap1/4 were larger than those of the diplotype Hap1/3.

Our study showed that the c.-1100 A > G within the SIRT6 gene promoter region could significantly influence carcass quality traits. Results gleaned from this study would be possibly contributed to better breeding plan and policies.

Conclusions

The current study suggested SIRT6 gene was predomiately expressed in subcutaneous fat, and composed of two SNPs in the promoter region in Chinese indigenous cattle. In addition, the SNP c.-1100 A > G and diplotype Hap4/4 (-CA-CG-) might influence fat deposition as a result of alteration in SIRT6 transcriptional activity. This may contribute to deep insights into genes associated with the adaptation and specialization of beef cattle breeds in China.

Notes

Abbreviations

Hif1α: 

Hypoxia inducible factor 1, alpha

KDR: 

Kinase insert domain receptor

LD: 

Linkage disequilibrium

PPARγ: 

Peroxisome proliferator activated receptor gamma

qPCR: 

Quantitative real-time polymerase chain reactions

SIX1: 

SIX homeobox 1

SNPs: 

Single nucleotide polymorphisms

SREBP: 

Sterol regulatory element binding protein

Declarations

Acknowledgements

All the authors of the manuscript are immensely grateful to their respective universities and institutes for their technical assistance and valuable support in the completion of this research project.

Funding

The research was supported by the National Natural Science Foundation of Qinghai Province (2018-ZJ-922Q) and the Science and Technology Department Project of Qinghai province (2017-NK-108).

Availability of data and materials

All data generated or analysed during this study are included in this published article.

Authors’ contributions

LG and SHAR designed the experiment and performed the experiments. LG,YS and YH wrote the manuscript assisted in analyzing the data provided constructive suggestions for the discussion, MG and IU were involved in interpretation of data, drafting the manuscript and revising it critically for intellectual content also assisted in the language modification. All authors read and approved the final manuscript.

Ethics approval

All animal experiments were conducted according to the guidelines established by the regulations this work was performed at a farm in the Department of Animal Sciences and Technology at Qinghai University, China. Ethical approval for this study was obtained from the Ethical Committee of Qinghai University. The procedures were approved by the Ethical Committee of China Animal Care Qinghai University.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
State Key Laboratory of Plateau Ecology and Agriculture, Qinghai University, Xining, Qinghai Province, 810016, People’s Republic of China
(2)
College of Agriculture and Animal Husbandry, Qinghai University, Xining, Qinghai Province, 810016, People’s Republic of China
(3)
College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi, 712100, People’s Republic of China
(4)
Utah State University, School of Animal Dairy and Veterinary Sciences, Logan, UT 84322, USA
(5)
Academy of Animal Science and Veterinary Medicine, Qinghai University, Xining, Qinghai Province, 810016, People’s Republic of China
(6)
College of Bio-medical engineering Chongqing University Chongqing, Shapingba 400044, People’s Republic of China

References

  1. Luft FC. Are you certain about SIRT? J Mol Med. Springer. 2014;92:305–6.View ArticleGoogle Scholar
  2. Han S-H. Potential role of sirtuin as a therapeutic target for neurodegenerative diseases. J Clin Neurol. 2009;5:120–5.View ArticleGoogle Scholar
  3. Gan L, Mucke L. Paths of convergence: sirtuins in aging and neurodegeneration. Neuron Elsevier. 2008;58:10–4.View ArticleGoogle Scholar
  4. Michishita E, McCord RA, Berber E, Kioi M, Padilla-Nash H, Damian M, et al. SIRT6 is a histone H3 lysine 9 deacetylase that modulates telomeric chromatin. Nature. Nature Publishing Group. 2008;452:492.View ArticleGoogle Scholar
  5. Zhong L, D’Urso A, Toiber D, Sebastian C, Henry RE, Vadysirisack DD, et al. The histone deacetylase Sirt6 regulates glucose homeostasis via Hif1α. Cell. Elsevier. 2010;140:280–93.View ArticleGoogle Scholar
  6. Kim H-S, Xiao C, Wang R-H, Lahusen T, Xu X, Vassilopoulos A, et al. Hepatic-specific disruption of SIRT6 in mice results in fatty liver formation due to enhanced glycolysis and triglyceride synthesis. Cell Metab. Elsevier. 2010;12:224–36.View ArticleGoogle Scholar
  7. Schwer B, Schumacher B, Lombard DB, Xiao C, Kurtev MV, Gao J, et al. Neural sirtuin 6 (Sirt6) ablation attenuates somatic growth and causes obesity. Proc Natl Acad Sci. 2010;107:21790–4.View ArticleGoogle Scholar
  8. Elhanati S, Kanfi Y, Varvak A, Roichman A, Carmel-Gross I, Barth S, et al. Multiple regulatory layers of SREBP1/2 by SIRT6. Cell Rep. Elsevier. 2013;4:905–12.View ArticleGoogle Scholar
  9. Kanfi Y, Peshti V, Gil R, Naiman S, Nahum L, Levin E, et al. SIRT6 protects against pathological damage caused by diet-induced obesity. Aging Cell. Wiley Online Library. 2010;9:162–73.View ArticleGoogle Scholar
  10. Pastinen T, Hudson TJ. Cis-acting regulatory variation in the human genome. Science. American Association for the Advancement of Science. 2004;306:647–50.View ArticleGoogle Scholar
  11. Gui L, Jiang B, Zhang Y, Zan L. Sequence variants in the bovine silent information regulator 6, their linkage and their associations with body measurements and carcass quality traits in Qinchuan cattle. Gene. Elsevier. 2015;559:16–21.View ArticleGoogle Scholar
  12. Gui L-S, Zhang Y-R, Liu G-Y, Zan L-S. Expression of the SIRT2 gene and its relationship with body size traits in Qinchuan cattle (Bos taurus). Int J Mol Sci. Multidisciplinary Digital Publishing Institute. 2015;16:2458–71.View ArticleGoogle Scholar
  13. Rincon G, Farber EA, Farber CR, Nkrumah JD, Medrano JF. Polymorphisms in the STAT6 gene and their association with carcass traits in feedlot cattle. Anim Genet. Wiley Online Library. 2009;40:878–82.View ArticleGoogle Scholar
  14. Gui L, Hong J, Raza SH, Zan L. Genetic variants in SIRT3 transcriptional regulatory region affect promoter activity and fat deposition in three cattle breeds. Mol Cell Probes. Elsevier. 2017;32:40–5.View ArticleGoogle Scholar
  15. Ardlie KG, Kruglyak L, Seielstad M. Patterns of linkage disequilibrium in the human genome. Nat Rev Genet. 2002;3:299–309.View ArticleGoogle Scholar
  16. Hausman GJ, Basu U, Du M, Fernyhough-Culver M, Dodson MV. Intermuscular and intramuscular adipose tissues: Bad vs. good adipose tissues. Adipocyte. Taylor & Francis. 2014;3:242–55.View ArticleGoogle Scholar
  17. Cui H-X, Liu R-R, Zhao G-P, Zheng M-Q, Chen J-L, Wen J. Identification of differentially expressed genes and pathways for intramuscular fat deposition in pectoralis major tissues of fast-and slow-growing chickens. BMC Genomics. BioMed Central. 2012;13:213.View ArticleGoogle Scholar
  18. Ramayo-Caldas Y, Fortes MRS, Hudson NJ, Porto-Neto LR, Bolormaa S, Barendse W, et al. A marker-derived gene network reveals the regulatory role of PPARGC1A, HNF4G, and FOXP3 in intramuscular fat deposition of beef cattle. J Anima Sci. Oxford University Press. 2014;92:2832–45.View ArticleGoogle Scholar
  19. Robinson DL, Cafe LM, Greenwood PL. Meat science and muscle biology symposium: developmental programming in cattle: consequences for growth, efficiency, carcass, muscle, and beef quality characteristics. J Anim Sci. Oxford University Press. 2013;91:1428–42.View ArticleGoogle Scholar
  20. Liszt G, Ford E, Kurtev M, Guarente L. Mouse Sir2 homolog SIRT6 is a nuclear ADP-ribosyltransferase. J Biol Chem ASBMB. 2005;280:21313–20.View ArticleGoogle Scholar
  21. Budayeva HG, Rowland EA, Cristea IM. Intricate roles of mammalian sirtuins in defense against viral pathogens. J Virol. 2016;90:5–8.View ArticleGoogle Scholar
  22. Jiang H, Khan S, Wang Y, Charron G, He B, Sebastian C, et al. SIRT6 regulates TNF-α secretion through hydrolysis of long-chain fatty acyl lysine. Nature. Nature Publishing Group. 2013;496:110.View ArticleGoogle Scholar
  23. Dali-Youcef N, Lagouge M, Froelich S, Koehl C, Schoonjans K, Auwerx J. Sirtuins: the ‘magnificent seven’, function, metabolism and longevity. Ann Med. Taylor & Francis. 2007;39:335–45.View ArticleGoogle Scholar
  24. Chen NB, Ma Y, Yang T, Lin F, Fu WW, Xu YJ, et al. Tissue expression and predicted protein structures of the bovine ANGPTL3 and association of novel SNPs with growth and meat quality traits. Animal. Cambridge University Press. 2015;9:1285–97.View ArticleGoogle Scholar
  25. Bai Y, Zhang JB, Xue Y, Peng YL, Chen G, Fang MY. Differential expression of CYB5A in Chinese and European pig breeds due to genetic variations in the promoter region. Anim Genet. Wiley Online Library. 2015;46:16–22.View ArticleGoogle Scholar
  26. Wei D-W, Gui L-S, Raza SHA, Zhang S, Khan R, Wang L, et al. NRF1 and ZSCAN10 bind to the promoter region of the SIX1 gene and their effects body measurements in Qinchuan cattle. Sci Rep. Nature Publishing Group. 2017;7:7867.View ArticleGoogle Scholar
  27. Fu Y, Sun W, Xu C, Gu S, Li Y, Liu Z, et al. Genetic variants in KDR transcriptional regulatory region affect promoter activity and intramuscular fat deposition in Erhualian pigs. Anim Genet. Wiley Online Library. 2014;45:373–80.View ArticleGoogle Scholar
  28. Deihimi T, Niazi A, Ebrahimi M, Kajbaf K, Fanaee S, Bakhtiarizadeh MR, et al. Finding the undiscovered roles of genes: an approach using mutual ranking of coexpressed genes and promoter architecture-case study: dual roles of thaumatin like proteins in biotic and abiotic stresses. SpringerPlus. Nature Publishing Group. 2012;1:30.View ArticleGoogle Scholar
  29. Akey J, Jin L, Xiong M. Haplotypes vs single marker linkage disequilibrium tests: what do we gain? Eur J Hum Genet Ejhg. 2001;9:291–300.View ArticleGoogle Scholar

Copyright

© The Author(s). 2018

Advertisement

BMC Genomics

ISSN: 1471-2164

Contact us