Skip to main content
Download PDF

Identification of Campylobacter jejuni and Chlamydia psittaci from cockatiel (Nymphicus hollandicus) using metagenomics

BMC Genomics volume 22, Article number: 797 (2021) Cite this article

Abstract

Background

In July 2015, the carcasses of 11 cockatiels were submitted for disease diagnosis to the Avian Disease Division of the Animal and Plant Quarantine Agency of Korea. The cockatiels, which appeared dehydrated and underweight, had exhibited severe diarrhea and 22 % mortality over 2 weeks. Traditional diagnosis did not reveal the causes of these symptoms.

Methods

We conducted metagenomics analysis on intestines and livers from the dead cockatiels using Illumina high-throughput sequencing. To obtain more accurate and longer contigs, which are required for further genetic characterization, we compared the results of three de novo assembly tools (metaSPAdes, MEGAHIT, and IDBA-UD).

Results

Sequence reads of Campylobacter jejuni (C. jejuni) and Chlamydia psittaci (C. psittaci) were present in most of the cockatiel samples. Either of these bacteria could cause the reported symptoms in psittaciformes. metaSPAdes (ver.3.14.1) identified the 1152 bp flaA gene of C. jejuni and the 1096 bp ompA gene of C. psittaci. Genetic analysis revealed that flaA of C. jejuni was recombinant between C. jejuni and Campylobacter coli, and that ompA of C. psittaci isolated from cockatiel was closely related to strains isolated from humans.

Conclusions

C. jejuni and C. psittaci were detected in cockatiels in the Republic of Korea using metagenomic analysis. This approach is useful for understanding pathogens of pet birds. Three de novo assemblers were compared to obtain accurate contigs from large quantities of reads, and sequences of C. jejuni and C. psittaci generated by metaSPAdes were analyzed.

Peer Review reports

Background

Transmittable diseases of parrots include pulmonary diseases such as psittacosis, influenza, histoplasmosis, Newcastle disease, Q fever, and West Nile virus fever; gastrointestinal diseases such as salmonellosis, campylobacteriosis, and giardiasis; and cutaneous diseases such as pasteurellosis, erysipeloid cryptococcosis, mite dermatitis, and nontuberculous mycobacteriosis [1]. In addition, a few viral diseases, such as proventricular dilation disease caused by avian bornavirus, psittacine beak and feather disease caused by circovirus, and polyomavirus infection (also called budgerigar fledgling disease and Pacheco’s disease) caused by psittacid herpesvirus 1, are frequently lethal to pet birds [2,3,4,5]. Many pet bird diseases are asymptomatic but can be transmitted to humans via inhalation or ingestion of infected or contaminated material [1]. Campylobacter, Salmonella, and Arcobacter have been detected in apparently healthy pet birds, indicating that these animals are potential carriers of these enteropathogens to humans [6]. Zoonotic transmission of disease from psittacid species is uncommon but still represents a public health danger [7]. Therefore, disease diagnosis and pathogen identification in parrots are important for public health and potential to human-infection pathogens.

No parrot species are native to the Republic of Korea, but import of pet parrots has recently increased (Fig. 1) despite bans on unregulated trafficking. Meanwhile, the pet bird industry, including breeding facilities, parrot shops, and pet bird owners, has grown exponentially. Cockatiels (Nymphicus hollandicus) are popular pet parrots around the world because they are gregarious, small, and elegantly colored; moreover, their propagation in captivity is relatively simple. Several studies have described diseases of cockatiels and the fecal microbiomes of healthy cockatiels [8,9,10], but information on cockatiel diseases is limited relative to the body of knowledge on other birds such as poultry.

Fig. 1
figure 1

Number of imported parrots approved by the Animal and Plant Quarantine Agency of the Republic of Korea between 2002 and 2019 (http://eminwon.qia.go.kr/statistics)

Full size image

Traditional diagnostic methods, such as microorganism culture, nucleic acid amplification tests, and serologic assay, which require a great deal of time and labour, and have limitations for finding the etiology of infectious disease [11]. Recent advances in high-throughput sequencing technologies have been used for pathogen detection and discovery [12]. Metagenomics, which can reveal a high degree of microbial diversity, can be used to determine the etiology of diseases with unknown causes [13,14,15].

In this study, we conducted metagenomics analysis to elucidate the cause of diarrhea in cockatiels that had not been revealed by traditional diagnosis. In addition, we compared the results of three de novo assemblers to obtain accurate sequences of Campylobacter jejuni (C. jejuni) and Chlamydia psittaci (C. psittaci), and then performed genetic characterizations on these sequences.

Methods

Samples and purification

In July 2015, the carcasses of 11 cockatiels were submitted for disease diagnosis to the Avian Disease Division of the Animal and Plant Quarantine Agency (APQA). The 30-day-old birds appeared dehydrated and underweight, and had exhibited severe diarrhea and 22 % mortality over the course of 2 weeks. The dead cockatiels were shipped the next day refrigerated and inspected. On the basis of clinical manifestations and the presence of gross lesions, necropsy, bacteriological culture using three culture media per sample, defibrinated sheep blood agar plate, MacConkey agar plate and LB broth, virus isolation using specific pathogen-free embryonated chicken eggs, pathological examination, and electron microscopy were performed according to an APQA diagnostic protocol. Each of the 11 cockatiels had been bred in the same place and had similar symptoms and gross lesions, so 4 samples were chosen at random for metagenomic analysis. To identify the pathogen, the intestines (ileum and colon) and livers of four cockatiels (15AD75-1 to 15AD75-4) were collected after necropsy, pooled for each individual, and promptly processed via blending into a 10 % homogenate in sterile phosphate-buffered saline (PBS) containing 0.4 mg/mL gentamicin. Healthy chicken trachea samples were used as negative control for the sample pretreatment and sequencing. The homogenates were centrifuged at 3,500 r.p.m. and 13,000 r.p.m. for 10 min each. To remove large particles, the supernatants of intestine homogenates were filtered using 0.8 and 0.45 μm syringe filters. To eliminate free DNA, viral particles were pelleted by ultracentrifugation (30,000 r.p.m., 5 h, 4 °C), resuspended in 500 µL of 1 M Tris-Cl (pH 7.4), and treated with 2.5 units of DNase I (AMPD1; Sigma-Aldrich, St. Louis, MO, USA) for 3 h at 37 °C. The sample was concentrated and washed twice using a Microcon 30 column (Millipore, USA). DNase activity was inhibited by addition of 0.5 M EDTA to a final concentration of 20 mM.

High-throughput sequencing

The homogenates were immediately frozen and kept at -80 ℃ until RNA extraction. Total RNA was extracted from purified samples using the Viral Gene-spin Viral DNA/RNA Extraction Kit (iNtRON Biotechnology, Republic of Korea). cDNA synthesis and PCR amplification of nucleic acid were carried out in a 50 µL mixture containing 5 µg RNA, 0.5 µM random primer K (GAC CAT CTA GCG ACC TCC AC), and 0.5 µM primer KN (GAC CAT CTA GCG ACC TCC CAN NNN NNN N) as described previously [16] using the Access RT-PCR system (Promega, USA). The products were purified using an UltraClean PCR Clean-up Kit (MO BIO, USA) and sequenced at Theragen Etex (Suwon, Republic of Korea). Sample libraries were prepared using the Illumina TruSeq DNA sample preparation kit (Illumina, USA), and DNA was fragmented using a Covaris adaptive focused acoustics device to generate double-stranded DNA fragments 300–400 bp in size. The ends were repaired, phosphorylated, and 3’-end adenylated.

Paired-end DNA adaptors (Illumina) were ligated, and construct fragments of ~500 bp were selected. Libraries were loaded onto a paired-end flow cell and sequenced as 101 bp paired-end, indexed reads on an Illumina HiSeq 2500 instrument. The raw read sequences were filtered using the following exclusion criteria: (1) presence of ambiguous bases (letter N) in excess of 10 %; (2) average quality below 20; (3) more than 5 % of nucleotides with quality below 20; or (4) the presence of an adapter sequence. Total reads were aligned with the NCBI RefSeq viral, bacterial, and fungal genome database using the Burrows–Wheeler Aligner software (ver.0.7.12). To annotate the reads, homology-based (BLAST) classification (ver.2.2.31) based on the nucleotide sequence was performed using the NCBI ‘nucleotide’ database. Taxonomy was determined using in-house script based on the NCBI taxonomy database (blastn e-value cutoff < e−450 ) [17,18,19].

Sequence analysis

To obtain more accurate assembled sequences, we compared the results of three assembly tools, IDBA-UD (ver.1.1.1) [20], MEGAHIT (ver.1.2.9) [21], and metaSPAdes (ver.3.14.1) [22]. The three assemblers were run using 96 threads (Intel® Xeon® Platinum 8260 Processor, 2CPU). MEGAHIT used the least peak memory (average 3.77 Gb) and had the shortest runtime (average 1.07 h). By contrast, IDBA-UD and metaSPAdes required higher memory consumption and longer times (55.41 Gb and 3.25 h; 44.6 Gb and 3.39 h, respectively). Quality of contigs was analyzed by MetaQUAST (ver.5.0.2) misassemblies are defined by the following criteria (a) the left flanking sequence aligns over 1 kb away from the right flanking sequence on the reference (b) flanking sequences overlap on more than 1 kb (c) flanking sequences align to different strands or different chromosomes (d) flanking sequences align on different reference genomes; mismatches per 100 kb are defined by the following criteria (a) the average number of mismatches per 100,000 aligned bases (b) True SNPs and sequencing errors are not distinguished and are counted equally; indels per 100 kb is the average number of indels per 100,000 aligned bases. Several consecutive single nucleotide indels are counted as one indel [23]. With minimum alignment of 65 bp and 95–100 % identity. Sequences were extracted using Seqs-Extractor (ver.1.1.2). RDP (ver.4.1.01) was used for detection and analysis of recombination [24]. Sequences were aligned and analyzed using the CLC main workbench 7 (CLC Bio, Denmark). Phylogenetic trees were generated by the neighbor-joining method with 1,000 bootstrap replications using the MEGA 10 software [25] on related species published in the DDBJ/EMBL/GenBank database.

Results

Disease diagnosis of cockatiels

The only gross lesion in the dead cockatiels was weak fibrinous perihepatitis. Escherichia coli was identified in the liver by bacteriological culture. The presence of avian bornavirus, avian polyomavirus, beak and feather disease virus, and psittacid herpesvirus 1 was investigated by PCR, but none of these viruses were detected. Hemagglutination test on harvested allantoic fluid was negative. Microscopic lesions were observed in liver multifocal hepatitis, perivascular lymphocyte and heterophil infiltration, minor pericarditis, and lung congestion.

Metagenomics analysis

Four cockatiel samples (15AD75-1, -2, -3, and -4) were sequenced, yielding 8,160,360 to 14,041,743 reads each. All reads of four cockatiel samples and control were broadly classified into one of four groups: (1) eukaryotic (95.2–99.9 %), (2) bacterial (<0.1–1.7 %), (3) viral (<0.1 %), and (4) unidentified (<0.1–3.9 %). Unidentified reads may not be coding region because sequencing of conserved neighboring genes improves taxonomic assignment when analyzing metagenomes using Sanger sequencing [26]. Homology-based (BLAST) classification of 1,614–144,494 bacterial reads identified four different bacterial species with sequence identity to avian bacteria. The identified bacterial sequences were assigned to known families, including C. jejuni (Campylobacteraceae), C. psittaci (Chlamydiaceae), Escherichia coli (Enterobacteriaceae), and Clostridium colinum. C. jejuni was detected in all four samples, and C. psittaci sequences were detected in three (15AD75-1, -2, and -3). Sequence reads classified as Enterobacteriaceae were identified in sample 15AD75-2, and C. coli sequences were identified in sample 15AD75-1. Although the sample preparation enriched for viruses, viral sequence reads represented fewer than 0.1 % of reads in three samples and were completely absent in the other sample, 15AD75-4 (Table 1). C. jejuni and C. psittaci were detected in three or four samples. Because these two organisms are pathogens in psittaciformes, we analyzed both in detail.

Table 1 Number of reads assigned using BLAST with cockatiel samples and control sample
Full size table

Comparison of the de novo assembly tools

To obtain more accurate and longer sequence contigs of bacteria, we compared the results of three de novo assemblers (IDBA-UD, MEGAHIT, and metaSPAdes) using reads classified as C. jejuni from sample 15AD75-1 and reads classified as C. psittaci from sample 15AD75-3. The most accurate assembly was generated by metaSPAdes with 0 misassemblies, 1383.12 mismatches per 100 kb, and 15.4 indels per 100 kb in C. jejuni. Moreover, metaSPAdes had only one misassembly with 40.68 mismatches per 100 kb and 8.62 indel per 100 kb in C. psittaci. The most inaccurate assembly was generated by MEGAHIT. In C. jejuni, MEGAHIT yielded slightly longer contigs, with N50 of 681, largest alignment of 3,004, and genome fraction of 3.84 %, but had the most misassemblies (4). Similarly, in C. psittaci, MEGAHIT yielded slightly longer contigs, with N50 of 1,104, largest alignment of 5,732, and genome fraction of 61.90, but also had most misassemblies (13). IDBA-UD had intermediate accuracy, with no misassemblies in C. jejuni but 11 in C. psittaci (Table 2).

Table 2 Statistics of Campylobacter jejuni and Chlamydia psittaci contigs compared with results of three assembly tools using MetaQUAST
Full size table

Next, using sample 15AD75-1, we compared C. jejuni 16S rRNA gene sequences, generated by IDBA-UD, MEGAHIT, and metaSPAdes assembly tools, with the reference sequence of C. jejuni ZJB021 (GenBank accession no. CP048767.1). The sequence aligned by IDBA-UD had a 28 nt insertion at positions 451–478 (GGGAGTAAAGTTAATACCTTTGCTCAT) instead of TTC, as well as various misassemblies, but sequences obtained using MEGAHIT and metaSPAdes had no misassemblies. MEGAHIT and metaSPAdes showed 100 % nt identity with the 16srRNA gene of Campylobacter jejuni ZJB021 (accession no. CP048767.1) but IDBA-UD only had 74 % nt identity (Fig. 2 A). We then compared ompA sequences of C. psittaci from sample 15AD75-3, generated by IDBA-UD, MEGAHIT, and metaSPAdes, with the reference sequence C. psittaci GIMC 2005 (GenBank accession no. CP024451.1). Sequences aligned by IDBA-UD and MEGAHIT had many misassemblies at positions 541–994 and consisted of short contigs (615 nt), but the sequence obtained using metaSPAdes had zero misassemblies and was 994 nt in length. MetaSPAdes showed 100 % nt identity with the ompA gene of Chlamydia psittaci 15AD75-3 (GenBank accession no. MW544064) but IDBA-UD and MEGAHIT only provided 59 % nt identity (Fig. 2B). Thus, more accurate and longer sequences were generated by metaSPAdes. These sequences were deposited in the GenBank database under accession numbers MW534394 and MW544064.

Fig. 2
figure 2

Comparison of contigs generated by alignment sequence using IDBA-UD, MEGAHIT, and metaSPAdes assembly tools. A Comparison of the 16srRNA gene of Campylobacter jejuni 15AD75-1 (GenBank accession no. MW534394) with that of C. jejuni ZJB021 (GenBank accession no. CP048767.1) B Comparison of the ompA gene of Chlamydia psittaci 15AD75-3 (GenBank accession no. MW544064) with that of C. psittaci GIMC 2005 (GenBank accession no. CP024451.1). Red boxes indicate misassembled regions

Full size image

Genetic analysis

To genetically characterize the identified bacteria relative to known references, we generated phylogenetic trees of the flaA gene of C. jejuni and the ompA gene of C. psittaci using the neighbor-joining method. Figure 3A shows three clusters of flaA sequences that were not correlated with host or country. C. jejuni 15AD75 was closely related to a cluster in genogroup A but was not sub-grouped with other strains. This partial flaA gene (1152 bp) of 15AD75 (accession no. MW544065) had 89.61 % nucleotide identity to strain C. jejuni 9090 (accession no. CP007181.1), but also had 91.23 % nucleotide identity to strain C. coli RM4661 (accession no. CP007181.1). In the recombination analysis using RDP, we detected a significant recombination event between breakpoints (positions 1121 and 1377), with C. coli RM4661 (Turkey, USA) as the minor parent (P-value = 1.351 × 10-8) and C. jejuni 9090 (Human, Slovenia) as the major parent (Fig. 4A). Recombination was supported by bootstrap support with a P-value of 3.609 × 10-12 (Fig. 4B). 15AD75 had 97.6 % nucleotide sequence identity with Campylobacter coli (C. coli) RM4661 (accession no. CP007181.1) and 75.1 % identity with C. jejuni 9090 (accession no. CP007181.1) at breakpoints. The breakpoint sequences were closer to C. coli than to C. jejuni.

Fig. 3
figure 3

Phylogenetic analysis of nucleotide sequences of (A) flaA of Campylobacter jejuni and (B) ompA of Chlamydia psittaci, generated by the neighbor-joining method using MEGA X with 1,000 bootstrap replications. Strains identified in this study are indicated in bold

Full size image

In the phylogram, ompA of the C. psittaci was clustered in genotype A, the major genotype associated with strains from parrots, chicken, and humans (Fig. 3B). C. psittaci 15AD75 was similar to reference parrot strains (accession no. MH507065.1, MH507064.1, KR010621.1, MH138297.1, CP003790.1, KR010619.1, KR010620.1), with more than 99.89 % sequence identity. In addition, it was similar to human isolates, with 100 % and 99.87 % identity to strains from Russia (accession no. CP024453.1, CP024451.1, CP024455.1) and Japan (accession no. AB468956.1), respectively.

Fig. 4
figure 4

Pairwise identity plot (A) and bootstrap support plot (B) achieved by multiple sequence alignments of flaA of Campylobacter spp. using Recombination Detection Program (RDP4). flaA of strain 15AD75 (C. jejuni) was recombinant, sharing homology with strain 9090 (C. jejuni) and RM4661 (C. coli)

Full size image

Discussion

The efficiencies of next-generation sequencing platforms such as Ion Torrent, Illumina, and Nanopore have been compared for metagenomic sequencing [27, 28]. Metagenomic sequencing-based approaches to disease diagnosis have the potential to overcome the shortcomings of both culture and PCR [29, 30]. Metagenomic analysis has a few limitations. Assuming the same depth of sequencing, samples with an abundance of non-pathogen RNA show lower analytical sensitivity than samples in which pathogen RNA is more abundant. The more reads that are sequenced, the further the sensitivity but also cost increases [31, 32]. The sensitivity limitations could be overcome with a host depletion method, which would reduce the proportion of host being sequenced, leading to better coverage over pathogens without having to sequence at higher depth. Few studies have compared bioinformatics tools devoted to tasks such as de novo assembly and annotation. When we use metagenomics for diagnosis of disease, both accurate sequencing and identification of pathogen genes are necessary to analyze gene characteristics, as culture and isolation processes are not available. In this study, we found that metaSPAdes generated more accurate assemblies than MEGAHIT or IDBA-UD when using the same fastq data, but required a great deal of additional computational resources and processing time. MEGAHIT is a de novo assembler designed for assembly of large and complex metagenomics data in a time- and cost-efficient manner [21]. Therefore, we recommended using metaSPAdes to achieve the most accurate results, and MEGAHIT when it is necessary to minimize cost or processing time.

Using metagenomics analysis, we identified two bacteria, C. jejuni and C. psittaci, from sick cockatiels, that both pathogens were not cultured and identified in the traditional method, and obtained accurate long sequence reads using the metaSPAdes assembly tool. So, metagenomic can be used for pathogen detection beyond the shortcomings of culture. Additional genetic analysis of sequences from both bacteria revealed that the C. jejuni identified in this study was recombinant with C. coli and C. psittaci had strong homology with strains isolated from humans.

C. jejuni is an enteric organism that is well adapted to avian hosts, and most Campylobacter infections produce minimal or no disease. However, consumption of poultry meat, which has a high prevalence of Campylobacter, is a significant cause of human food poisoning [33, 34]. Previously, Campylobacter had not been detected in the normal microbiota of psittacines such as cockatiels and scarlet macaws [9, 35, 36], and some studies reported that C. jejuni causes diarrhea in young chicks, turkey poults, and Japanese quail [34]. In addition, recombination of the flaA gene can increase antigenic diversity, allowing the bacterium to escape the immunological responses of the host [37]. Some variants of C. jejuni have a greater capacity to survive environmental pressures and colonize the host gut [38]. Accordingly, this species could have been responsible for the diarrhea observed in the sick cockatiels examined in this study.

Order Psittaciformes contains the species that are most susceptible to chlamydial infection, which causes economic losses in both the pet bird and poultry industries, and represents a public health threat to people in close contact with infected birds [39, 40]. Clinically, chlamydial infections in most avian species produce severe airsacculitis and pneumonitis, although pharyngeal specimens from many healthy cockatiels have high titers of chlamydia [41]. Because the cockatiels tested in this study had digestive diseases such as diarrhea and perihepatitis, but not respiratory diseases, the C. psittaci identified by our metagenomics analysis might have been involved in subclinical infections.

Identification of C. jejuni and C. psittaci in pet birds is significant for public health. Campylobacter has emerged as a leading cause of foodborne gastroenteritis in humans worldwide [42]. In addition, C. jejuni invades tissue and induces inflammation, resulting in the post-infection autoimmune disease Guillain–Barré syndrome [43]. Many types of birds can be infected by C. psittaci. Domestic and companion birds are considered the main risk for transmission of psittacosis to humans [44]. The US Centers for Disease Control and Prevention reported 935 human cases of psittacosis from 1988 to 2003, most of which were related to contact with Psittaciformes [45]. Therefore, a surveillance program to control diseases of pet birds, including C. psittaci infections, as well as pet bird hygiene and biosecurity management of all bird-related transactions, are needed as soon as possible to decrease the prevalence of these infections.

Conclusions

C. jejuni and C. psittaci were detected for the first time by metagenomic analysis in cockatiels in the Republic of Korea. The findings of this study are useful for understanding pet bird pathogens. Three de novo assemblers were compared to obtain accurate contigs from large quantities of reads, and the sequences of C. jejuni and C. psittaci generated by metaSPAdes were analyzed.

Availability of data and materials

The reference genomes used during the current study are publicly available and were downloaded from the NCBI nucleotide database (https://www.ncbi.nlm.nih.gov/nuccore). BWA is available at (https://github.com/lh3/bwa) under the GPLv3 License. BLAST is available at (https://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastDocs&DOC_TYPE=Download). IDBA-UD is available at (https://github.com/loneknightpy/idba) under the GPLv2 License. MEGAHIT is available at (https://github.com/voutcn/megahit) under the GPLv3 License. metaSPAdes is available at (https://github.com/ablab/spades) under the GPLv2 License.

The DNA-sequencing data were deposited to Sequence Read Archive (SRA) under accession number PRJNA756392.

Abbreviations

APQA:

Animal and Plant Quarantine Agency

BLAST:

Basic Local Alignment Search Tool

C. coli :

Campylobacter coli

C. jejuni :

Campylobacter jejuni

C. psittaci :

Chlamydia psittaci

kb:

Kilobase

nt:

Nucleotide

RDP:

Recombination Detection Program

References

  1. Jorn KS, et al. Polly can make you sick: pet bird-associated diseases. Cleve Clin J Med. 2009;76(4):235–43.

    Article  Google Scholar 

  2. Rinder M, et al. Broad tissue and cell tropism of avian bornavirus in parrots with proventricular dilatation disease. Journal of virology. 2009;83(11):5401–7.

    Article  CAS  Google Scholar 

  3. Garnett, S., Threatened and extinct birds of Australia. 1993.

  4. Szweda M, et al. Avian polyomavirus infections in Amazon parrots. Medycyna Weterynaryjna. 2011;67(3):147–50.

    Google Scholar 

  5. Simpson CF, Hanley J, Gaskin J. Psittacine herpesvirus infection resembling Pacheco’s parrot disease. Journal of Infectious Diseases. 1975;131(4):390–6.

    Article  CAS  Google Scholar 

  6. Seifi S, Khoshbakht R, Azizpour A. Occurrence of Campylobacter, Salmonella, and Arcobacter in pet birds of northern Iran. Journal of the Hellenic Veterinary Medical Society. 2019;70(4):1771–6.

    Article  Google Scholar 

  7. Boseret G, et al. Zoonoses in pet birds: review and perspectives. Veterinary Research. 2013;44(1):36.

    Article  Google Scholar 

  8. R, M., Epidemiologic and laboratory observations of Chlamydia psittaci infection in pet birds. Journal of the American Veterinary Medical Association, 1984. 184(11): p. 1372–1374.

  9. Alcaraz L, D HAM, Peimbert M. Exploring the cockatiel (Nymphicus hollandicus) fecal microbiome, bacterial inhabitants of a worldwide pet. PeerJ. 2016;4:e2837.

    Article  Google Scholar 

  10. Hameed S, S GJ, Tizard. I, Shivaprasad H, L, Payne S. Studies on immunity and immunopathogenesis of parrot bornaviral disease in cockatiels. Virology. 2018;515:81–91.

    Article  CAS  Google Scholar 

  11. D TP, et al. Comparing the outcomes of patients with carbapenemase-producing and non-carbapenemase-producing carbapenem-resistant Enterobacteriaceae bacteremia. Clinical Infectious Diseases. 2017;64(3):257–64.

    Article  CAS  Google Scholar 

  12. Mokili JL, Rohwer F, Dutilh BE. Metagenomics and future perspectives in virus discovery. Current opinion in virology. 2012;2(1):63–77.

    Article  CAS  Google Scholar 

  13. Edwards RA, Rohwer F. Viral metagenomics. Nature Reviews Microbiology. 2005;3(6):504–10.

    Article  CAS  Google Scholar 

  14. Kim H-R, et al. Identification of a picornavirus from chickens with transmissible viral proventriculitis using metagenomic analysis. Archives of virology. 2015;160(3):701–9.

    Article  CAS  Google Scholar 

  15. Kim H-R, et al. Viral metagenomic analysis of chickens with runting-stunting syndrome in the Republic of Korea. Virology Journal. 2020;17(1):1–10.

    Article  Google Scholar 

  16. Stang A, Korn K, Wildner O, Uberla K, Characterization of virus isolates by particle-associated nucleic acid PCR. J Clin Microbiol. 2005;43(2):716–20.

    Article  CAS  Google Scholar 

  17. Pruitt KD, Tatusova T, Maglott DR. NCBI reference sequences (RefSeq): a curated non-redundant sequence database of genomes, transcripts and proteins. Nucleic acids research. 2007;35(suppl_1):D61–5.

    Article  CAS  Google Scholar 

  18. Johnson M, et al. NCBI BLAST: a better web interface. Nucleic acids research. 2008;36(suppl_2):W5–9.

    Article  CAS  Google Scholar 

  19. Li, H., Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. arXiv preprint arXiv:1303.3997, 2013.

  20. Peng. Y, Yiu LHC, Chin SM, Y F. IDBA-UD: a de novo assembler for single-cell and metagenomic sequencing data with highly uneven depth. Bioinformatics. 2012;28(11):1420–8.

    Article  CAS  Google Scholar 

  21. Dinghua Li C-ML, Luo Ruibang, Sadakane Kunihiko, Lam Tak-Wah. MEGAHIT: an ultra-fast single-node solution for large and complex metagenomics assembly via succinct de Bruijn graph. Bioinformatics. 2015;31(10):1674–6.

    Article  CAS  Google Scholar 

  22. Sergey Nurk DM, Korobeynikov Anton, Pevzner Pavel A. metaSPAdes: a new versatile metagenomic assembler. Genome Res. 2017;27(5):824–34.

    Article  CAS  Google Scholar 

  23. Mikheenko A, Gurevich SV. MetaQUAST: evaluation of metagenome assemblies. Bioinformatics. 2016;32(7):1088–90.

    Article  CAS  Google Scholar 

  24. Martin D. P, Murrell B, Golden M, Khoosal A, Muhire B, RDP4: Detection and analysis of recombination patterns in virus genomes. Virus Evol. 2015;1(1):vev003.

    Article  Google Scholar 

  25. Kumar S, et al. MEGA X: molecular evolutionary genetics analysis across computing platforms. Molecular biology and evolution. 2018;35(6):1547–9.

    Article  CAS  Google Scholar 

  26. Weng FC, et al. Reanalyze unassigned reads in Sanger based metagenomic data using conserved gene adjacency. BMC bioinformatics. 2010;11(1):1–10.

    Article  CAS  Google Scholar 

  27. Charalampous. Themoula, K.G.L., Richardson. Hollian, Aydin. Alp, Baldan. Rossella, Jeanes. Christopher, Rae. Duncan, Grundy. Sara, Turner. Daniel J, Wain. John, Nanopore metagenomics enables rapid clinical diagnosis of bacterial lower respiratory infection. Nature Biotechnology, 2019. 37(7): p. 783-792.

  28. Tausch. Simon H, Andrusch SB, Andreas Loka, Tobias P, Lindner. Martin S. Nitsche. Andreas, Renard. Bernhard Y. LiveKraken––real-time metagenomic classification of illumina data Bioinformatics. 2018;34(21):3750–2.

    PubMed  CAS  Google Scholar 

  29. Chiu Charles Y. Clinical metagenomics. Nature Reviews Genetics. 2019;20(6):341–55.

    Article  CAS  Google Scholar 

  30. Loman Nicholas J, Dallman Timothy MRV, Constantinidou J, Chrystala, Gharbia Saheer E. Wain John, Pallen Mark J, Performance comparison of benchtop high-throughput sequencing platforms. Nature biotechnology. 2012;30(5):434–9.

    Article  CAS  Google Scholar 

  31. Ebinger A, Fischer S, Höper D. A theoretical and generalized approach for the assessment of the sample-specific limit of detection for clinical metagenomics. Computational and structural biotechnology journal. 2021;19:732–42.

    Article  CAS  Google Scholar 

  32. Graf EH, et al. Unbiased Detection of Respiratory Viruses by Use of RNA Sequencing-Based Metagenomics: a Systematic Comparison to a Commercial PCR Panel. J Clin Microbiol. 2016;54(4):1000–7.

    Article  CAS  Google Scholar 

  33. Sahin Orhan KII, Shen Zhangqi Lin, Jun Rajashekara, Gireesh Zhang, Qijing. Campylobacter in poultry: ecology and potential interventions. Avian Diseases. 2015;59(2):185–200.

    Article  CAS  Google Scholar 

  34. David E. Swayne, M.B., Catherine M. Logue, Larry R. McDougald, Venugopal Nair, David L. Suarez, Sjaak de Wit, Tom Grimes, Deirdre Johnson, Michelle Kromm, Teguh Yodiantara Prajitno, Ian Rubinoff, Guillermo Zavala Disease of poultry 14ed. 2019: p. 737–750

  35. Bulbow Holden WJ, Debra Turner, Ian McEntire Michael Tizard. Campylobacter colonization is not associated with proventricular dilatation disease in psittacines. Veterinary Medicine: Research and Reports. 2017;8:37.

    CAS  Google Scholar 

  36. Xenoulis Panagiotis G, G.P.L., Brightsmith Donald, Palculict Blake, Hoppes Sharman, Steiner Jörg M, Tizard Ian, Suchodolski Jan S, Molecular characterization of the cloacal microbiota of wild and captive parrots. Veterinary microbiology, 2010. 146(3-4): p. 320-325.

  37. Clare S. Harrington, F.M.T.-C., Philip E. Carter, Evidence for Recombination in the Flagellin Locus of Campylobacter jejuni Implications for the Flagellin Gene Typing Scheme. JOURNAL OF CLINICAL MICROBIOLOGY, 1997. 35: p. 2386–2392.

  38. Ridley AM, Cawthraw MJT SA, Wassenaar TM, Newell DG. Genetic instability is associated with changes in the colonization potential of Campylobacter jejuni in the avian intestine. J Appl Microbiol. 2008;105(1):95–104.

  39. Andersen Arthur A. Avian chlamydiosis. Revue scientifique et technique. International Office of Epizootics). 2000;19(2):396–404.

    Google Scholar 

  40. Kaleta EF. Avian host range of Chlamydophila spp. based on isolation, antigen detection and serology. Avian pathology. 2003;32(5):435–62.

    Article  CAS  Google Scholar 

  41. A AA. Comparison of pharyngeal, fecal, and cloacal samples for the isolation of Chlamydia psittaci from experimentally infected cockatiels and turkeys. Journal of Veterinary Diagnostic Investigation. 1996;8(4):448–50.

    Article  Google Scholar 

  42. S MP, et al. Food-related illness and death in the United States. Emerging infectious diseases. 1999;5(5):607.

    Article  Google Scholar 

  43. Blaser MJ. Epidemiologic and Clinical Features of Campylobacter jejuni Infections. The Journal of Infectious Diseases. 1997;176(Supplement_2):S103–5.

    Article  Google Scholar 

  44. Taher H, Tom G, Daisy V. Chlamydophila psittaci infections in birds: a review with emphasis on zoonotic consequences. Veterinary microbiology. 2009;135(1–2):68–77.

    Google Scholar 

  45. Gary Balsamo AMM, Joanne W, Midla Julia M, Murphy Ron, Wohrle Thomas M, Edling, Pilar H, Fish Keven, Flammer Denise, Hyde Preeta K, Kutty Miwako, Kobayashi Bettina, Helm Brit, Oiulfstad Branson W, Ritchie Mary Grace, Stobierski Karen, Ehnert Thomas N, Tully Jr. Compendium of Measures to Control Chlamydia psittaci Infection Among Humans (Psittacosis) and Pet Birds (Avian Chlamydiosis), 2017. J Avian Med Surg. 2017;31(3):262–82.

    Article  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

This work was supported by grants from the Animal and Plant Quarantine Agency (grant F-1543084-2021-22-01) of the Ministry of Agriculture, Food and Rural Affairs of the Republic of Korea.

Author information

Authors and Affiliations

  1. Avian Disease Division, Animal and Plant Quarantine Agency, 177 Hyeoksin 8-ro, Gyeongsangbuk-do, 39660, Gimcheon-si, Republic of Korea

    Si-Hyeon Kim, Yong-Kuk Kwon & Hye-Ryoung Kim

  2. Animal Disease Intervention Center, College of Veterinary Medicine, Kyungpook National University, 41566, Daegu, Republic of Korea

    Choi-Kyu Park

Authors
  1. Si-Hyeon Kim
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Yong-Kuk Kwon
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Choi-Kyu Park
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Hye-Ryoung Kim
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

All authors designed experiments, SH Kim performed all analyses, SH Kim and HR Kim wrote this manuscript. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Hye-Ryoung Kim.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Kim, SH., Kwon, YK., Park, CK. et al. Identification of Campylobacter jejuni and Chlamydia psittaci from cockatiel (Nymphicus hollandicus) using metagenomics. BMC Genomics 22, 797 (2021). https://doi.org/10.1186/s12864-021-08122-y

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12864-021-08122-y

Keywords

BMC Genomics

ISSN: 1471-2164

Contact us