Open Access

Identification of miRNAs with potential roles in regulation of anther development and male-sterility in 7B-1 male-sterile tomato mutant

BMC Genomics201516:878

https://doi.org/10.1186/s12864-015-2077-0

Received: 23 March 2015

Accepted: 13 October 2015

Published: 28 October 2015

Abstract

Background

The 7B-1 tomato line (Solanum lycopersicum cv. Rutgers) is a photoperiod-sensitive male-sterile mutant, with potential application in hybrid seed production. Small RNAs (sRNAs) in tomato have been mainly characterized in fruit development and ripening, but none have been studied with respect to flower development and regulation of male-sterility. Using sRNA sequencing, we identified miRNAs that are potentially involved in anther development and regulation of male-sterility in 7B-1 mutant.

Results

Two sRNA libraries from 7B-1 and wild type (WT) anthers were sequenced and thirty two families of known miRNAs and 23 new miRNAs were identified in both libraries. MiR390, miR166, miR159 were up-regulated and miR530, miR167, miR164, miR396, miR168, miR393, miR8006 and two new miRNAs, miR#W and miR#M were down-regulated in 7B-1 anthers. Ta-siRNAs were not differentially expressed and likely not associated with 7B-1 male-sterility. miRNA targets with potential roles in anther development were validated using 5′-RACE. QPCR analysis showed differential expression of miRNA/target pairs of interest in anthers and stem of 7B-1, suggesting that they may regulate different biological processes in these tissues. Expression level of most miRNA/target pairs showed negative correlation, except for few. In situ hybridization showed predominant expression of miR159, GAMYBL1, PMEI and cystatin in tapetum, tetrads and microspores.

Conclusion

Overall, we identified miRNAs with potential roles in anther development and regulation of male-sterility in 7B-1. A number of new miRNAs were also identified from tomato for the first time. Our data could be used as a benchmark for future studies of the molecular mechanisms of male-sterility in other crops.

Keywords

7B-1 mutation Solanum lycopersicum Male-sterility Abiotic stress Another development Meiosis

Background

The spontaneous 7B-1 mutant in tomato (Solanum lycopersicum cv. Rutgers) is a photoperiod-dependent male-sterile line, where in long days flowers are male-sterile with stamens that are shrunken and produce non-viable microspores [1]. In short days, flowers are fertile and produce normal stamens and viable pollen. A proteomic study suggested that microsporogenesis in 7B-1 breaks down prior to the meiosis in microspore mother cells (MMCs), which was associated with altered levels of several important proteins involved in tapetum degeneration and MMCs development [2]. Compared to the WT, 7B-1 has a higher tolerance to various abiotic stresses, specifically under blue light, is less sensitive to light-induced inhibition (i.e., de-etiolation) of hypocotyl growth, to blue light-induced stomata opening [3], and has an elevated level of endogenous ABA, but less GAs, IAA, and CKs [46]. Fellner and Sawhney, [5] demonstrated that there was a defect in blue light perception in 7B-1, which affected hormonal sensitivity and their endogenous levels. This information adds on to the fact that the 7B-1 is a complex mutation with its primary effect still unknown. As a stress-tolerant male-sterile mutant, 7B-1 is a valuable germplasm for hybrid tomato breeding [7].

Recent studies have documented important regulatory functions of sRNAs in plant growth and development. There are two main types of sRNAs based on their biogenesis: small interfering RNAs (siRNAs), and microRNAs (miRNAs). siRNAs are processed from perfectly double-stranded RNA (dsRNA) and comprise different classes; those produced from dsRNA synthesized by RNA dependent RNA polymerase 6 (RDR6) (trans-acting or ta-siRNAs) [8, 9], by RDR2 (heterochromatin siRNAs) [10], or by overlapping antisense mRNAs (natural antisense siRNAs) [11]. While ta-siRNAs target mRNAs similarly to miRNAs, heterochromatin siRNAs cause DNA methylation and/or heterochromatin formation that lead to transcriptional gene silencing [12].

Ta-siRNAs play essential roles in regulating plant development, metabolism and responses to biotic and abiotic stresses [13]. Four families of TAS genes comprising eight loci have been identified in Arabidopsis thaliana, among which miR173 targets both TAS1a/b/c family and TAS2 locus, miR390 targets TAS3a/b/c family, while miR828 triggers the production of TAS4-derived ta-siRNAs [1416]. TAS3a-derived tasiARFs, 5´D7(+) and 5´D8(+), target several ARFs, including ARF2, 3 and 4 [14, 17], which were proposed to act as suppressors in auxin signaling pathway [18]. Recently, a fifth TAS family (TAS5) was identified from tomato, which is triggered by miR482 [19].

Plant miRNAs are typically 21 nucleotides (nt) long, which are derived from single-stranded RNA transcripts that have the ability to fold into imperfect stem-loop secondary structures. These hairpins are processed by the ribonuclease III-like enzyme Dicer (DCL1) into miRNA/miRNA* duplexes. One of the strands of the miRNA/miRNA* duplex (usually mature miRNA) is incorporated into the RNA induced silencing complex (RISC), which guides the RISC to recognize target mRNA based on sequence complementarity. Mature miRNAs suppress the expression of their target genes by cleavage of the target mRNAs or translational repression [20]. Many plant miRNAs are conserved among species and have been implicated in processes, such as development, signal transduction, abiotic stress tolerance, and resistance to pathogens [2123]. High-throughput sequencing was first used to identify tomato sRNAs, including miRNAs from young green fruits and more recently from several developmental stages of the fruits [2427].

Recently, there is a growing interest towards understanding the role of miRNAs in regulation of male-sterility in plants. Even though there is no evidence that any miRNAs directly cause male-sterility in plants, it was suggested that miRNAs and their target genes play important roles in regulation of male-sterility. Wei et al., [28] identified several conserved and new miRNAs, which were differentially expressed during anther development in a male-sterile cotton mutant. These miRNAs targeted HD-Zip III-like, ARF4, AP2 and ACC oxidase 3 genes, which are key genes involved in hormone signaling, cell patterning, and anti-oxidant metabolism.

Zhang et al., [29] reported that miR156, miR159, miR164, miR166, miR172 and miR319 were differentially expressed in sporogenous cell, MMCs and microspores between a male-sterile cotton and its maintainer line. The predicted targets for these miRNAs were involved in cotton growth and development, signal transduction and metabolism pathways. Jiang et al., [30] identified 15 miRNAs, which were differentially expressed in pollens of a male-sterile line of Brassica campestris and its wild type. There are increasing evidences showing that the function of miRNAs, including miR156, miR159, miR164, miR167, miR172 and miR319 is crucial during flower development and microsporogenesis [3133]. MiR159 directs the cleavage of GAMYB-related transcripts, which are involved in regulation of anther development and microsporogensis [34, 35]. Overexpression of miR159 in Arabidopsis thaliana resulted in sterile anthers [36]. MiR167 targets ARF6/8, which regulate ovule and anther development [31]. In Arabidopsis thaliana, overexpression of miR167 led to male-sterility [37]. Mutation in a sRNA locus in rice which produced a 21-nt sRNA has led to environment-conditioned male-sterility [38].

sRNAs in tomato have been mainly studied in fruits development and ripening process, and no report has yet documented their involvement in regulation of male-sterility. The main goal of our study was to investigate whether sRNA biogenesis is affected by 7B-1 mutation, and if sRNAs, particularly miRNAs, are associated or involved in anther development and regulation of male-sterility in 7B-1. Known and new miRNAs, ta-siRNAs and their targets were identified and their expressions were studied in 7B-1 and WT anthers. Targets of miRNAs with potential roles in anther development and microsporogenesis were validated using 5′-RACE and localization of miRNAs was further analyzed by in situ hybridization.

Results

Deep sequencing of sRNAs

Anthers from the flower buds at three stages of pre-meiosis, meiosis, and post-meiosis (stages 1, 2, and 3) were dissected and pooled as described by Sheoran et al., [2]. Two sRNA libraries were constructed from WT and 7B-1 pooled anthers and sequenced, which produced about 108 and 52 million raw reads, respectively. After adaptor trimming, reads were mapped to the tomato (cv. Heinz) genome with no mis-matches allowed (Table 1). Size class distribution of total and unique sRNAs and their complexities in each library is presented in Fig. 1. The majority of sRNAs in both 7B-1 and WT libraries were 21–24 nt, and formed a bi-modal size distribution typical for plant sRNAs. In general, the peak represented by 24-nt size class is greater than the 21-nt class as reported in several plant species [25, 26, 29, 3942] with a few exceptions, as in grapevine, where the 21-nt class was more abundant than the 24-nt class in total read numbers, but not at unique read level [43], and in Brassica juncea, where the 21-nt class had the major peak in total and unique reads [44].
Table 1

Statistics of sRNA reads

Type

WT anthers

7B-1 anthers

Total

Unique

Total

Unique

Raw reads

108,515,964

 

52,194,436

 

Quality filtered

108,322,391

 

52,054,239

 

Adaptor removed

45,255,262

 

19,253,757

 

Genome matched

28,187,399

2,062,422

12,010,196

1,018,385

rRNA

1,171,580 (4.16 %)

6,480 (0.31 %)

466,773 (3.89 %)

4,796 (0.47 %)

tRNA

2,218,468 (7.87 %)

8,460 (0.41 %)

656,434 (5.47 %)

5,911 (0.58 %)

snoRNA

117,074 (0.42 %)

2,958 (0.14 %)

58,061 (0.48 %)

2,277 (0.22 %)

snRNA

107,893 (0.38 %)

8,235 (0.40 %)

46,202 (0.38 %)

5,783 (0.57 %)

Fig. 1

Size distribution of redundant (R) and non-redundant (NR) sRNA reads and their complexity in WT (panel a) and 7B-1 (panel b) anthers

In our study, the 21-nt class had a bigger peak than 24-nt class in total reads in both libraries; however, for the non-redundant distribution, the 24-nt class had the major peak in both libraries. Two key distinguishing features of sRNA libraries are the size distribution and population complexity as defined by the ratio of unique/total reads. The lower complexity of the 21-nt class in comparison to the 24-nt class in our study indicated that a relatively small number of unique reads were highly expressed in the 21-nt class, while the 24-nt class high complexity indicated the presence of more unique reads with less redundancy, which is also a typical feature of the 24-nt hcRNAs, where often are present in a more chaotic dicing pattern [45].

Identification of known and new miRNAs

Known miRNAs from 32 known families of miRNAs were identified, which were present in both 7B-1 and WT libraries (Additional file 1: Table S1). The composition of miRNA families was quite similar in the two libraries, and none showed a clear 7B-1 or WT-specific profile. Most of the families had several members, with exception of miR171, miR393, miR398, miR403, miR530, miR858, miR4414, miR8577, miR9471, and miR9474, which were represented only by one member in both libraries (Additional file 1: Table S1). After excluding sRNA reads homologous to known miRNAs and other non-coding RNAs from Rfam v.12 database, the remaining 20-22 nt reads were used as input for miRNA prediction using the miRCat tool [46, 47]. A total of 23 putative new miRNAs were identified in the two libraries, where 11 were present only in WT, 5 in 7B-1, and 7 in both libraries. The miRNA* sequences were found for two new miRNAs, which were present in both libraries and designated as miR#A and miR#B. These miRNAs formed near-perfect hairpin structures (Additional file 2: Figure S1).

Expression analysis of miRNAs

To identify miRNAs related to anther development and regulation of male-sterility in 7B-1, expressions of miRNAs were compared between 7B-1 and WT anther libraries. The two libraries were normalized using the reads per million (RPM) approach [48]. The differential expression analysis was conducted using the offset fold change (OFC) approach [25] and two-fold threshold was considered as a cutoff value. Among the known miRNAs, miR390, miR166, miR159 were up-regulated and miR530, miR167, miR164, miR396, miR168, miR393, and miR8006 were down-regulated in 7B-1 anthers (Table 2). MiR166 and miR164 had three and two iso-miRs, respectively, while the rest of differentially expressed miRNAs were present only by one member. Out of the total of 23 putative new miRNAs only two potential miRNAs, so-called mir#W and mir#M were differentially down-regulated in 7B-1. None of the new miRNAs with sequenced miRNA* strands were differentially expressed in 7B-1 (Additional file 1: Table S2 and Table S3).
Table 2

List of differentially expressed miRNAs between WT and 7B-1 anthers

miRNA

Sequence

Read counts

Normalized expression

DEa

p-value

WT

7B-1

WT

7B-1

Log2(WT/7B-1)

miR390

AAGCTCAGGAGGGATAGCGCC

600

668

255.4

667.4

−1.3

0.003063

miR166

TCTCGGACCAGGCTTCATTCC

1731139

1537345

736984.2

1536039.9

−1.1

0.00993

miR159

TTTGGATTGAAGGGAGCTCTA

8237

7112

3506.7

7106.0

−1.0

0.016877

miR530

TGCATTTGCACCTGCACCTCC

290

50

123.5

50.0

1.0

0.022945

miR167

TGAAGCTGCCAGCATGATCTA

640

97

272.5

96.9

1.3

0.004468

miR164

TGGAGAAGCAGGGCACGTGCA

2898

466

1233.7

465.6

1.4

0.002397

miR396

TTCCACAGCTTTCTTGAACTG

2750

422

1170.7

421.6

1.4

0.002397

miR168

CCCGCCTTGCATCAACTGAAT

370

45

157.5

45.0

1.5

0.001237

miR393

ATCATGCTATCCCTTTGGACT

453

39

192.9

39.0

1.9

5.90E-05

miR8006

TAGTTTTTGGACTGCAGGGGCACC

855

34

364.0

34.0

2.8

<0.00001

aDE is differential expression values which were calculated as log2-fold changes of the expression. Negative and positive values mean up- and down regulation of the expression in 7B-1, respectively. DE value of ±1 was considered as a cutoff value for significant changes of the expression

RT-qPCR validation of miRNAs expression

Expressions of known and new miRNAs of interest were further analyzed by RT-qPCR (Fig. 2) in 7B-1 and WT anthers (stages 1, 2, and 3) and stem. MiR159 and miR390 were up-regulated at similar extent in all stages of 7B-1 anthers. MiR167 and miR396 were down-regulated in all stages of 7B-1 anthers; more strongly at stage 1. MiR#M was strongly down-regulated in all stages of 7B-1 anthers, while miR#A and miR#B were not differentially expressed and their sequenced miRNA* strands were not detected by our RT-qPCR analysis. The RT-qPCR results were in general agreement with those from sequencing data. In 7B-1 stem, miR159, miR390, miR167 and miR#M were all up-regulated, while miR396, miR#A and miR#B were not differentially expressed. MiR#B* was not detected by RT-qPCR. The results showed a very distinct anther- or stem-specific expression pattern of miR167, miR396, and miR#M, which suggests that they may regulate different biological processes in these tissues.
Fig. 2

RT-qPCR validation of differentially expressed known and new miRNAs and miRNAs with miRNA*. Expression changes are presented as normalized fold changes between 7B-1 and WT reference tissue. Positive and negative values indicate up- and down-regulation of the expression, respectively. Two-fold threshold was considered as a cutoff value for significant changes in the expression. Error bars represent standard errors of three biological replicates based on DMNRT (p = 0.05)

Target prediction for known and new miRNAs

To better understand the biological roles of miRNAs in regulation of 7B-1 male-sterility, putative targets of differentially expressed known and new miRNAs were identified (Tables 3 and 4; cleavage-sites are listed in Additional file 1: Table S4). Target genes for many of known conserved miRNAs have been experimentally validated [9, 14, 17, 31, 32, 4952]. Predicted targets for known miRNAs in our study were also in agreement with those from the literature, however a number of new putative target genes were also computationally identified, which has yet to be validated. The miRNA targets were categorized into fifteen different biological classes (Fig. 3) with the three most frequent being metabolic process, cellular process, and single-organism process. Among the targets worth mentioning (Table 3) were those, including auxin-responsive factor 8 (ARF8), ABC transporters, G protein, F-box and no apical meristem (NAM) proteins, b-ZIP, SBP-box, MAD-box and MYB transcription factors with potential roles in anther development [5360], cystatin, receptor-like kinase, and bHLH proteins involved in tapetum development/degeneration [6163], kinesin-like protein and GRAS transcription factor involved in meiosis regulation [64, 65], and WD-40 protein with roles in autophagy and apoptosis [66]. Among the targets of new miRNAs (Table 4), a gene encoding pectinmethylesterase (PME) inhibitor (PMEI) was identified as the putative target of miR#M. PME is a cell wall modifying enzyme, which catalyzes de-esterification of pectin [67]. Identification of miRNA targets with potential roles in anther development and microsporogenesis regulation in our study, suggested that these miRNAs are likely associated or involved in regulation of 7B-1 male-sterility.
Table 3

List of the predicted targets of differentially expressed known miRNAs

miRNA

Target gene

SGN accession no

Annotation

miR166

Solyc02g024070.2.1

Class III HD-Zipa

 

Solyc03g006970.1.1

Subtilisin-like protease

 

Solyc03g116850.2.1

Cyclic nucleotide-binding

 

Solyc03g025740.2.1

Zinc finger

 

Solyc07g045410.1.1

Pentatricopeptide repeat-containing protein

miR390

Solyc00g009090.2.1

Receptor-like kinasea

 

Solyc09g091850.2.1

Beta-glucosidase

 

Solyc11g016930.1.1

serine/threonine-protein kinase

miR159

Solyc01g009070.2.1

GAMYBL1

 

Solyc01g102510.2.1

WD-40

 

Solyc02g078670.2.1

COP1-Interacting Protein 7

 

Solyc02g090160.2.1

G protein

 

Solyc03g043890.2.1

Aminotransferases

 

Solyc06g073640.2.1

GAMYBL2

 

Solyc07g052640.2.1

Glycosyltransferase-like protein

 

Solyc09g082890.1.1

Calcium-transporting ATPase 1

 

Solyc10g019260.1.1

MYB39-like

 

Solyc11g072060.1.1

MYB

 

Solyc01g005330.2.1

microtubule associated protein Type 1

miR530

Solyc01g091550.2.1

Aspartyl protease family

 

Solyc02g083460.2.1

Aspartyl protease family protein

 

Solyc02g084520.2.1

Zinc finger CCCH domain-containing protein 19

 

Solyc02g085520.2.1

Adenylosuccinate synthetase, chloroplastic

 

Solyc02g086930.2.1

Homeobox-leucine zipper-like protein

 

Solyc03g019920.1.1

Harpin-induced protein-like

 

Solyc03g093230.2.1

Aquaporin

 

Solyc04g009450.1.1

Ethylene-responsive transcription factor 4

 

Solyc04g081070.2.1

Heat shock protein DnaJ

 

Solyc06g063170.2.1

glutamate-like receptor

 

Solyc07g006030.2.1

Protein TIF31 homolog

 

Solyc08g007500.2.1

Pentatricopeptide repeat-containing protein

 

Solyc11g062220.1.1

PHD-finger domain protein

 

Solyc12g008690.1.1

Iaa-amino acid hydrolase 11

miR393

Solyc01g057310.2.1

Kinesin (Centromeric protein)-like protein

 

Solyc11g006310.1.1

GEX1

 

Solyc02g088800.1.1

Exocyst complex component 7

 

Solyc06g068840.2.1

Copine-3

 

Solyc08g081890.2.1

ABC transporter

miR396

Solyc01g066500.1.1

MAD-box transcription factor 22

 

Solyc00g105750.1.1

Mutator-like transposasea

 

Solyc00g071180.2.1

Cysteine proteinase inhibitor

 

Solyc01g090270.2.1

b-ZIP transcription factor

 

Solyc01g094930.2.1

CAAX prenyl protease 1

 

Solyc01g110450.2.1

Aldo/keto reductase subgroup

 

Solyc02g023950.2.1

Receptor like kinase

 

Solyc02g083190.1.1

F-box protein

 

Solyc03g058930.2.1

SPFH domain/Band 7 family protein

 

Solyc03g114150.2.1

Aldehyde dehydrogenase

 

Solyc03g118350.2.1

Actin-fragmin kinase

 

Solyc05g053090.1.1

GRAS transcription factora

 

Solyc06g007320.2.1

Ubiquitin-activating enzyme E1

 

Solyc06g059760.2.1

Transcriptional corepressor SEUSS

 

Solyc07g019640.1.1

Transposase

 

Solyc07g045480.2.1

Phytochrome F

 

Solyc09g057910.2.1

N-alpha-acetyltransferase 25

 

Solyc10g047270.1.1

Potassium transporter family protein

 

Solyc11g006680.1.1

Pentatricopeptide repeat-containing protein

 

Solyc11g020100.1.1

Cc-nbs-lrr, resistance protein

 

Solyc12g013840.1.1

G-protein beta WD-40 repeat

miR164

Solyc03g115850.2.1

No Apical Meristem (NAM)a

 

Solyc06g084350.2.1

U6 snRNA-associated Sm-like protein LSm2

 

Solyc11g066150.1.1

Bifunctional polymyxin resistance protein ArnA

miR167

Solyc02g037530.2.1

Auxin response factor 8a

 

Solyc01g010020.2.1

Flagellar calcium-binding protein

 

Solyc01g086900.2.1

tRNA/rRNA methyltransferase

 

Solyc01g099790.2.1

Zinc finger

 

Solyc03g007790.2.1

Serine/threonine protein kinase

 

Solyc03g117700.1.1

Folate/biopterin transporter

 

Solyc08g065360.2.1

Glutathione-regulated potassium-efflux system protein

 

Solyc08g069010.2.1

Pentatricopeptide repea

miR168

Solyc01g108250.2.1

Vacuolar import and degradation protein

 

Solyc04g078130.2.1

Clathrin-coat assembly protein-like

 

Solyc06g053710.2.1

Ethylene receptor

 

Solyc06g060160.1.1

C2 domain-containing protein

 

Solyc06g076700.1.1

Unknown protein

 

Solyc09g018560.1.1

Ulp1 protease family

 

Solyc09g090650.2.1

Zinc finger protein

miR8006

Solyc01g008530.2.1

Cinnamoyl CoA reductase-like proteina

 

Solyc01g008790.2.1

Phosphoesterase family protein

 

Solyc04g078250.2.1

Manganese transport protein mntH

 

Solyc05g014050.2.1

Inner membrane protein

 

Solyc07g049440.2.1

GDSL esterase/lipase

 

Solyc08g078650.2.1

Glycosyl transferase

 

Solyc09g064850.2.1

Glutathione peroxidase

 

Solyc10g009520.2.1

Dihydroflavonol-4-reductase

 

Solyc12g013850.1.1

Glycosyl transferase

 

Solyc12g088130.1.1

BHLH transcription factor

 

Solyc12g096640.1.1

RNA-binding protein

aindicates targets which have identified from multiple loci

Table 4

List of the predicted targets of new miRNAs

miRNA

Target gene

SGN accession no

Annotation

miR#W

Solyc01g008240.2.1

Sugar/inositol transporter

 

Solyc01g015110.1.1

Ulp1 proteasea

 

Solyc01g079390.2.1

Histone-lysine N-methyltransferase MEDEA

 

Solyc01g095910.1.1

Cytochrome b561/ferric reductase transmembrane

 

Solyc01g103670.2.1

Alpha/beta hydrolase fold-1 domain-containing protein

 

Solyc01g103800.2.1

Ribosomal protein S12e

 

Solyc01g104990.2.1

Trimethylguanosine synthase

 

Solyc02g022870.2.1

EMB1611/MEE22

 

Solyc02g069410.2.1

HAD-superfamily hydrolase subfamily IA variant 3

 

Solyc02g069740.2.1

Jumonji transcription facto

 

Solyc02g092780.1.1

Tetratricopeptide-like helical

 

Solyc03g078240.1.1

UDP-glucosyltransferase

 

Solyc03g115860.2.1

Endoplasmic reticulum membrane protein

 

Solyc04g074660.1.1

Folate-sensitive fragile site protein Fra10Ac1

 

Solyc04g079240.2.1

Patatin

 

Solyc05g007850.1.1

Tir-nbs-lrr, resistance protein

 

Solyc06g016750.2.1

CBF transcription factor

 

Solyc06g065180.2.1

SLL1 protein

 

Solyc06g083070.2.1

Actin filament bundling protein

 

Solyc08g014530.1.1

Subtilisin-like protein

 

Solyc08g069000.2.1

Zinc transport protein zntB

 

Solyc08g081290.2.1

ARID/BRIGHT DNA-binding protein

 

Solyc09g007370.2.1

Ribonuclease P protein subunit p29

 

Solyc09g083200.2.1

Nod factor receptor protein

 

Solyc09g089550.2.1

Zinc finger-homeodomain protein 2

 

Solyc10g084410.1.1

Phosphatase 2C family protein

 

Solyc12g027580.1.1

Exportin 4

 

Solyc12g077660.1.1

Nucleosome assembly protein (NAP)

miR#M

Solyc03g112990.1.1

Pectinesterase inhibitor

miR#A

Solyc03g119580.1.1

Ethylene-responsive transcription factor 4

 

Solyc10g078230.1.1

Cytochrome P450

miR#B

Solyc01g044350.2.1

Zinc finger (Ran-binding) family protein

 

Solyc02g089170.2.1

Alpha-1,4-glucan-protein synthase

 

Solyc03g113250.2.1

Nitrate transporter

 

Solyc04g007260.2.1

Thioesterase superfamily

 

Solyc04g009620.2.1

Chorismate synthase

 

Solyc04g071160.2.1

b-ZIP transcription factor

 

Solyc05g054890.2.1

ABC transporter G family member 1

 

Solyc06g084100.2.1

Protein phosphatase 2C

 

Solyc07g005390.2.1

Aldehyde dehydrogenase

 

Solyc07g007230.2.1

Heat shock protein

 

Solyc07g015870.2.1

Polygalacturonase 1

 

Solyc08g069030.2.1

Tetrapyrrole biosynthesis

 

Solyc09g074100.2.1

tRNA methyl transferase-like

 

Solyc09g091230.2.1

Glycosyl transferase

aindicates targets which have identified from multiple loci

Fig. 3

Gene ontology of miRNA targets. Predicted targets were categorized into different biological classes and numbers in the parenthesis indicate the frequency of members in each category

Identification of ta-siRNAs and prediction of their targets

TAS loci and their associated ta-siRNAs were predicted based on the phased 21 nt sRNAs characteristic of ta-siRNA loci [46]. Ta-siRNAs with abundance below 10 reads were excluded from the analysis. Twenty-five ta-siRNAs from WT, 7 from 7B-1 and 7 common in both libraries were identified and their target genes were predicted (Additional file 1: Table S5). As these ta-siRNAs had generally low abundances, those identified only in WT or 7B-1 could not be considered as WT- or 7B-1-specific and were not further analyzed. Instead, we focused on those which have been found in both libraries; however none were differentially expressed (Additional file 1: Table S5). Ta-siRNAs with phased expressions matching to the tomato TAS3 (Solyc01g058100.2.1) were also identified (Additional file 1: Table S6 and Table S7), however TAS3-derived 5′D7(+) and 5′D8(+) tasiARFs were not differentially regulated between the two libraries. The results suggested that ta-siRNAs were not likely associated or involved in regulation of male-sterility in 7B-1 as they were not differentially regulated.

5′-RACE validation of miRNA and ta-siRNA targets

The predicated targets of interest were validated in 7B-1 anthers (stage 1; where changes of the expression were strongest) and stem using 5′-RACE. Sequence analysis showed (Fig. 4) that the 5′ ends for most of the cleaved mRNA fragments corresponded to nucleotide complementary to the 10th nucleotide of the corresponding miRNA. MiR159 and miR319 could both cleave MYB transcripts [32]; however sequence analysis of the cleavage products showed that MYB cleavage in anthers and stem was directed by miR159, not miR319. Cleavage products of miR159 and miR319 can be readily distinguished as they differ in one base. Cleavage products of ARF8, target of miR167, were identified from anther, but not stem. Among the predicted targets of miR396, cleavage products of cystatin were identified in both anther and stem libraries, but not MAD-box. Cleavage products of PMEI, predicted target of miR#M, were also identified in both anther and stem libraries. Cleavage products of ARF2, 3 and 4, targets of D7 and D8 tasiARFs, were identified from both anther and stem libraries (Additional file 2: Figure S2). These results showed that the above mentioned miRNAs, including the newly identified miR#M as well as tasiARFs were functionally active in 7B-1 anther and stem, where directed the cleavage of their predicted target transcripts. Furthermore, it provided experimental evidence to support our target predictions.
Fig. 4

5′- RACE validation of miRNA target genes in 7B-1 anther and stem. Gene transcripts are in 5′-3′ and miRNAs in 3′-5′directions. The arrows indicate the cleavage sites of target mRNA and numbers above them indicate frequency (out of 10) of sequences found at the exact miRNAs cleavage sites. Watson-Crick pairing (vertical dashes), G-U wobble pairing (circles), and other mismatches (:) are indicated

RT-qPCR analysis of miRNA and ta-siRNA targets

Figure 5 shows RT-qPCR analysis of miRNA targets of interest and TasiARFs in 7B-1 anthers and stem. GAMYBL1 was down-regulated in anthers of all stages and more strongly in stem. ARF8 was up-regulated in anthers of all stages and stem. Cystatin and PMEI were both up-regulated in anthers of all stages, but down-regulated in stem. TasiARFs (D7 and D8) were not differentially expressed in anthers and stem. ARF2/3/4 were not differentially expressed in anthers, but up-regulated in stem (Additional file 2: Figure S3). Analysis showed a consistent negative correlation between miRNAs expression and accumulation level of their targets, except for miR390-TAS3-tasiARFs (in anthers and stem), and miR167-ARF8 (in stem). In addition to miRNA and their targets, expression of two cell wall modifying enzymes, cysteine protease and polygalacturonase, were also analyzed in 7B-1 anthers and stem (Additional file 2: Figure S4). Cysteine protease was down-regulated in anthers, more strongly at stage 3, while up-regulated in stem. Polygalacturonase was strongly down-regulated in anthers at stage 2, but not differentially regulated at stage 3, nor in stem.
Fig. 5

RT-qPCR validation of miRNA target genes and TasiARFs in 7B-1 anthers and stem. Expression changes are presented as normalized fold changes between 7B-1 and WT reference tissue. Positive and negative values indicate up- and down-regulation of the expression, respectively. Two-fold threshold was considered as a cutoff value for significant changes in the expression. Error bars represent standard errors of three biological replicates based on DMNRT (p = 0.05)

In situ hybridization

Figure 6 shows in situ localization of miR159, GAMYBL1, PMEI and cystatin in WT and 7B-1 anthers in the late meiotic (where still some tetrads could be seen together with the newly formed microspores) and in binucleate microspores stages as for the cases of PMEI and cystatin. MiR159, GAMYBL1 and cystatin were all predominantly expressed in tapetum, tetrads and free microspores in WT and more strongly in 7B-1 as the case of miR159 and cystatin. Panels L and M of the figure show WT and 7B-1 anthers, respectively at binucleate microspores stage, where tapetum was degenerated in WT, but not degenerated and vacuolated in 7B-1. Cystatin was strongly expressed in vacuolated tapetal cells in 7B-1 (Panel M). PMEI was strongly expressed in tapetum, tetrads and free microspores in 7B-1 anthers, but its expression was mainly restricted to tapetum at binucleate microspores stage (Panel H). As mentioned earlier, in some of the 7B-1 anthers, microspores were not separated and remained attached after meiosis. PMEI was strongly expressed in arrested binucleate microspores in 7B-1 (Panel I). No detectable hybridization signal was observed for the murine miR122a probe, which served as a negative control.
Fig. 6

In situ localization of miR159, GAMYBL1, PMEI and cystatin. a and b localization of miR159 in WT and 7B-1 anthers, respectively. c and d GAMYBL1 in WT and 7B-1 anthers, respectively. e and f PMEI in WT anthers at late meiotic and binucleate microspores stages, respectively. g, h, and i PMEI in 7B-1 anthers at late meiotic stage, free binucleate microspores, and arrested binucleate microspores, respectively. j and k cystatin in WT and 7B-1 anthers, respectively. l and m cystatin in WT and 7B-1 anthers at binucleate microspores stage, respectively. n negative control, where a murine miR122a-specific probe was used. Arrows indicate the localization sites

Discussion

The main goal of our study was to investigate the sRNA profiles, particularly miRNAs, between the 7B-1 mutant and WT anthers and to identify differentially expressed miRNAs and their targets with potential roles in anther development and regulation of male-sterility in 7B-1. Analysis showed that the overall size distribution and population complexity of sRNAs were quite similar between the 7B-1 and WT anther libraries. Composition of sRNAs could indicate the roles and activity level of different categories of sRNAs in a particular tissue or species or associated biogenetic machineries. In our study, the 21-nt class had a larger peak than the 24-nt class in total reads in both libraries; however, in non-redundant format, the 24-nt class had the major peak in both libraries. The 24-nt class was also found to be the major peak in anthers of a male-sterile cotton [28]. Higher abundance of the 21-nt class in total reads in anthers of 7B-1 and WT in our study, could suggest a more active roles for this class of sRNAs and an intensified contribution from miRNA biogenesis pathways that produce the more precisely defined sRNA species at those stages compared to those of other crops having the 24-nt class with higher redundancy.

Even though there is no direct evidence that any miRNAs are causative genes for male-sterility in plants, we hypothesized that differential expression of miRNAs could be associated with the regulation of male-sterility in 7B-1. Thirty-two families of known miRNAs were identified in both 7B-1 and WT anther libraries. Three and seven miRNA families were up and down-regulated, respectively in 7B-1 anthers. Out of the 23 putative new miRNAs only two, so-called miR#W and miR#M, were differentially expressed in 7B-1 anther. Expressions of miRNAs of interest were further analyzed at different stages of 7B-1 anthers and stem. In general, changes of the expression were strongest in anthers at stage 1, where the MMCs were about to undergo the meiosis. MiR167, miR396, and miR#M had distinctively different expression patterns in anthers and stem, which strongly suggested that these miRNAs regulate different biological processes in these tissues. The predicted targets of differentially expressed miRNAs were categorized into fifteen different biological classes, with metabolic process, cellular process, and single-organism process being the three most frequent classes. Among these miRNAs, miR159, miR167, miR396, miR390 and miR#M were those of particular interest as their targets had potential roles in anther development, microsporogenesis and production of ta-siRNAs as the case of miR390. A schematic presentation of miRNA-target pairs and their role in regulation of male-sterility in 7B-1 mutant is illustrated in Fig. 7. 5′-RACE validation of these miRNA targets in 7B-1 anther and stem showed that they were active and directed the cleavage of their targets in these tissues, except for miR167 in 7B-1 stem.
Fig. 7

Schematic presentation of miRNA-target pairs and their role in regulation of anther development and male-sterility in 7B-1 mutant. Arrows below miRNAs and miRNA targets show up- and down-regulation of the expression. “” indicates no change in the expression. Pictures of 7B-1 anthers are adopted from Sheoran et al., [2]

MiR159 targets several GAMYBs [55, 68, 69], among them AtMYB33, AtMYB65 act redundantly in regulation of anther development [55]. Overexpression of miR159 disrupted anther development and led to male-sterility in Arabidopsis thaliana [36]. 5′-RACE analysis in our study showed that miR159 directed the cleavage of GAMYBL1 transcripts out of the 4 predicted MYB targets in anther and stem. OsGAMYBL1 and 2 are expressed in rice anthers and regulated by miR159, however functions of these gene are not characterized [69]. LeGAMYBL1 plays a role in seed development in tomato [70], but it is not functionally characterized with respect to anther development. Analysis showed that the expression of GAMYBL1 was negatively correlated with the miR159 level in 7B-1 during anther development and in stem. In situ hybridization analysis in 7B-1 anthers also showed that miR159 and GAMYBL1 were both expressed mainly in tapetum, tetrads and microspores. MiR159 and GAMYBL1 were down- and up-regulated, respectively in GA-treated 7B-1 anthers (Additional file 2: Figure S5). These observations indicated that miR159-GAMYBL1 cleavage cascade and GA level in flower buds are tightly linked to the regulation of anther development and male-sterility in 7B-1.

Most of the elongated mutants have been reported as GA-overproducers [7173]; however elongated stem of 7B-1 had lower levels of GAs compared to WT in long days [4]. Several MYBs have been identified, which positively regulate stem elongation in light via interaction with phytochromes and/or regulation of light-responsive genes [74, 75]. Down-regulation of GAMYBL1 in 7B-1 stem is likely associated with the elongated stem phenotype, however functional analysis are needed to understand the actual function of this gene.

MiR167 cleaves ARF6/8 transcripts [76]; however we only identified ARF8 in our target prediction, which was also validated by 5′-RACE in 7B-1 anther. Tomato overexpressing miR167 and arf6-arf8 double-null mutant of Arabidopsis thaliana both had flowers with severe defects associated with female and male-sterilities, respectively [76, 77]. Therefore, proper regulation of miR167-ARF6/8 is required for normal female and male organ development. RT-qPCR analysis showed strong down-regulation of miR167 in 7B-1 anthers, which was negatively correlated with regulation of ARF8 in anthers. Although differential regulation of miR167-ARF8 cleavage cascade in 7B-1 anthers could be linked and due to 7B-1 mutation, its actual function with respect to anther development and male-sterility in 7B-1 remains to be further characterized. In 7B-1 stem, neither the ARF8 cleavage products were found nor the ARF8 expression was correlated with miR167 level. Tomato overexpressing miR167 had lower levels of ARF6/8 transcripts and a shorter hypocotyl [76], while other researchers reported that light-grown Arabidopsis thaliana arf8-1 mutant had elongated hypocotyl [78]. Although up-regulation of miR167 and ARF8 in 7B-1 stem could be independently associated and/or affected by 7B-1 mutation, understanding their functions with respect to anther development and male-sterility in 7B-1 requires further functional analysis.

To the best of our knowledge no reports have yet documented ta-siRNAs in regulation of male-sterility in plants. Ta-siRNAs including TAS3-derived tasiARFs were not differentially expressed between 7B-1 and WT; however miR390 was up-regulated in 7B-1 anther and stem. This suggested that although miR390 expression was affected by 7B-1 mutation, ta-siRNA biogenesis and tasiARFs-guided regulation of ARF2/3/4 were not affected by 7B-1 mutation nor related to anther development in 7B-1. Nevertheless, 5′-RACE analysis showed that tasiARFs are active in 7B-1 anther and stem, where directed the cleavage of ARF2/3/4 transcripts. Target genes of ARF2/3/4 are largely unknown, thus the mechanisms linking these ARFs to a context-specific role in regulation of 7B-1 stem growth if any are poorly understood.

Our cytological studies showed (Additional file 2: Figure S6; unpublished data) that anther development in 7B-1 (between anther lobes and/or among anthers) was not synchronized in contrast to the WT. We observed that MMCs did undergo meiosis and formed tetrads despite the previous report suggested a breakdown of meiosis in MMCs [2]. More importantly, we found that in some anther lobes, the newly formed microspores were not separated, while in others they formed free microspores. In qrt1 and qrt2 mutants of Arabidopsis thaliana, microspores failed to separate from tetrads as pectin was not degraded in the primary cell wall [79]. PMEI (miR#M target) was up-regulated in 7B-1 anthers, where the expression was mainly localized in tapetum, tetrads and microspores. PMEI was strongly expressed in the arrested binucleate microspores, compared to the free binucleate microspores, where a basal expression was detected. PMEs and PMEIs are key regulators of pollen cell wall and pollen tube development [7981]. Up-regulation of PMEI in 7B-1 anthers may have suppressed the PME activity and impaired the subsequent enzymatic degradation of pectin in the primary cell walls around tetrads. In qrt3, mutation in a gene encoding a polygalacturonase (pectin modifying enzyme) impaired the degradation of pectin in the primary cell wall, similar to qrt1 and qrt2 mutants [82]. Polygalacturonase was also down-regulated in 7B-1 anthers in our study. Based on our cytological and transcriptional data, we suggest a potential association between the regulation of miR#M-PMEI and polygalacturonase and anther development in 7B-1 as inhibition of PME and polygalacturonase activities could have disrupted pectin degradation and proper separation of tetrads and/or tapetum degeneration. However, it could not be the cause of male-sterility in 7B-1 as some of the anthers were still able to produce mature pollens.

Arabidopsis thaliana overexpressing PME showed reduced cell elongation in hypocotyl [83]. Al-Qsous et al., [84] suggested that higher level of PME transcript in elongated hypocotyl of flax was associated with cell wall stiffening. Overexpression of a polygalacturonase gene, PGX1, enhanced hypocotyl elongation in etiolated Arabidopsis thaliana [85]. Understating the function of PME and polygalacturonase in regulation of stem elongation in 7B-1 if they have indeed altered the pectin level and how they are connected to the cell expansion requires further analysis.

While conserved miRNAs regulate expression of the genes involved in basic developmental processes, the non-conserved or new miRNAs may be involved in the development of traits that are specific for certain species. New miRNAs are being continually identified from different species, including tomato [24, 25]. In addition to miR#M, we identified a number of new miRNAs, two with sequenced miRNAs*, which could form a near prefect hairpin structures.

Sheoran et al., [2] identified a number of differentially expressed proteins between 7B-1 and WT anthers, where cystatin showed the strongest up-regulation of all in 7B-1 anthers. The cystatin inhibitory activity was also higher in 7B-1 anthers relative to WT [2]. In plants, cysteine proteases act as key regulators of programmed cell death in tapetal cells and pollen development, and suppression of their expression has often resulted in delay or failure in tapetum degeneration, pollen abortion and male-sterility [62, 8688]. MiR396 directed the cleavage of cystatin in 7B-1 anthers and stem. Cystatin was up-regulated and cysteine protease was strongly down-regulated as a result in 7B-1 anthers, with a pattern closely correlated to the tapetum degeneration during anther development. These observations provided a strong evidence to suggest that suppression of cysteine protease could have caused a delay or failure in tapetum degeneration, thereby affecting microsporogenesis and anther development in 7B-1. The length of stem in 7B-1 is tightly correlated with the length of epidermal cells [6]. Minic et al., [89] identified several cysteine proteases in developing stems of Arabidopsis thaliana, suggested to be involved in cell expansion and secondary wall formation. Higher expression of cysteine protease in our study could be associated with the higher cell expansion rate and longer epidermis cells in 7B-1 stem. Overall in our study, we found that miRNA-mediated regulation of gene expression was perturbed in the 7B-1 mutant line. The findings strongly supported that miR159-GAMYBL1, miR396-cystatin and miR#M-PMEI cleavage cascades were tightly connected to the regulation of microsporogenesis and anther development in 7B-1. Stem elongation in 7B-1 may be regulated via a complex web of molecular components and interaction between miRNAs and hormones, which requires further functional studies to be understood. A number of new miRNAs were also identified for the first time from tomato, which provides new opportunities to study the unexplored functions of these miRNAs in tomato. Our data could be used as a benchmark for future studies of the molecular mechanisms of male-sterility in other crops.

Conclusion

Using sRNA sequencing, we studied miRNA profiles during anther development between 7B-1 mutant and WT. Comparison of expression of miRNAs and their targets between 7B-1 and WT and in situ localization analysis suggested potential involvement of several miRNA-target pairs in regulation of anther development and male-sterility in 7B-1. In addition a number of new miRNAs were identified and validated for the first time from tomato.

Availability of supporting data

The sequences could be found in NCBI database under accession number GSE65788.

Methods

Plant materials

The 7B-1 mutant and WT seedlings (Solanum lycopersicum L., cv. Rutgers) were grown in temperature controlled growth chamber set for long days condition (16/8 h light/dark). Flower buds of different sizes smaller, equal and bigger than 4-5 mm (referred as stages 1, 2, and 3 hereafter) were collected and stamens were dissected under a microscope. It should be noted that stamens at these stages were mostly consisted of anthers, with little or on filament growth. Stages of flower buds were based on those described by Sheoran et al., [2] and also further confirmed by analysis of anther squashes. Flower buds at stage 1 represents pre-meiotic anthers, stage 2 is where tetrads are formed in WT anthers (meiotic anthers), but meiosis breaks down in MMCs in 7B-1 [2]. Stage 3 represents post-meiotic anthers. Stems from three-month old seedlings were used for qPCR and 5′-RACE analysis.

RNA analysis

Total RNA was extracted using the RNeasy Plant Mini Kit (Qiagen) from 7B-1 and WT anthers of different stages and pooled separately in equimolar ratio. Two sRNA libraries were constructed using the TruSeq Small RNA Sample Preparation Kit (Illumina). In brief, sRNA fractions of 18–40 nt were isolated from 15 % denaturing polyacrylamide gels, ligated to the 5′ and 3′ TruSeq adaptors and then converted to DNA by RT-PCR following the kit protocol. The final PCR products were purified from the gel and sequenced using Illumina Hiseq2000 platform (Illumina)

Sequence analysis

Adaptor sequences trimmed and reads were mapped (no mismatch allowed) to the tomato genome ITAG v2.5 Release using PatMaN [90] and a customized Perl script. Reads mapping to tomato repeats, transposons, intron, CDs, and promoter regions were identified. Sequences were searched against rRNA, tRNA, snRNAs and snoRNAs from Rfam v.12 and NCBI nt/nr databases. Known miRNAs were identified using miRprof [47], (available from the UEA sRNA workbench; http://srna-tools.cmp.uea.ac.uk/) allowing two mismatches with the mature miRNAs in miRBase database release 21 [91]. New miRNAs were predicted using miRCat (UEA sRNA toolkit), and their secondary structures were analyzed using a RNA hairpin folding and annotation tool (UEA sRNA toolkit). The parameters for miRcat included a minimum of 17 nucleotides paired, a maximum of two gaps between the miRNA and miRNA*, a maximum of 10 genomic hits, a minimum hairpin length of 70 nt, a minimum GC content of 20 %, a maximum of 60 % unpaired nucleotides and a strand bias of 80 % of sequences on one strand (regardless of the strand). These parameters were determined empirically on plant datasets [46, 47]. The significance testing for the secondary structure was conducted with RandFold [92].

Targets of miRNAs were predicted (allowing 4 mismatches) using the tomato ITAG cDNA v2.5. Expression values of miRNAs were normalized against the total number of genome-mapping reads [48] and changes in the expression were calculated as offset-fold change as described in Mohorianu et al., [25]. The p-values were calculated based on the standardized distribution of differential expression for all genome-matching sRNAs. TAS loci were predicted based on phased 21-nt sRNAs characteristic of ta-siRNA loci using a TASI prediction tool (UEA sRNA toolkit). Gene ontologies were assigned using the Blast2go tool (http://www.blast2go.com/b2ghome).

Quantitative PCR

Expressions of miRNAs and ta-siRNAs were validated using the Mir-X™ miRNA First-Strand Synthesis and SYBR® RT-qPCR kit (Clontech). In a single reaction, sRNA molecules were polyadenylated and reverse transcribed using poly(A) polymerase and SMART™ MMLV Reverse Transcriptase provided by the kit. List of miRNA and ta-siRNA forward primers is provided in Additional file 1: Table S8. U6 small nuclear RNA was used as a reference for data normalization. QPCR conditions were set at 95 °C for 10 s, followed by 40 cycles of 95 °C for 5 s, and annealing/extension at 60 °C for 20 s. Changes of expressions were calculated as normalized fold ratios using the ΔΔCT method [93]. QPCR validations of miRNA target genes were carried out using the SensiFAST SYBR Lo-ROX kit (Bioline). First-strand cDNAs were synthesized using the PrimeScript First Strand cDNA Synthesis kit (Takara). Gene-specific primers spanning the miRNA cleavage sites were designed and listed in Additional file 1: Table S8. Housekeeping α-tubulin and CAC genes were used as reference genes for data normalization (data were shown only for α-tubulin). PCR conditions were set at 95 °C for 2 min, followed by 40 cycles of 95 °C for 5 s, and annealing/extension at 60 °C for 20 s.

5′-RACE analysis

miRNA targets of interest were functionally validated using the GeneRacer kit (Invitrogen) through RNA ligase-mediated rapid amplification of 5′ cDNA ends (RLM-5′ RACE). In brief, 5 μg of total RNA was used to purify the mRNA. The 5′ RNA adaptor was ligated to the degraded mRNA with a 5′ free phosphoric acid by T4 RNA ligase, followed by a reverse transcription reaction. Subsequently, 1 μl of 10X diluted reverse transcription product was used to amplify the 5′ end of the corresponding targets using the 5′ GeneRacer and 3′ gene-specific primers. Final PCR products were analyzed by gel electrophoresis and cloned into the pCR®4-TOPO vector (Invitrogen). Ten different colonies were subjected to sequence analysis. The reverse gene-specific primers are listed in Additional file 1: Table S9.

In situ hybridization

Flower buds were fixed overnight in 4 % paraformaldehyde, then dehydrated using a graded ethanol series (50, 70, 95 and 100 %) and embedded in Paraplast® Plus™ chips. Transverse sections of 8 μM thick were prepared from the embedded blocks using a Leica Ultracut R ultramicrotome (Leica Bensheim, Germany). In situ hybridization was carried out following the protocol described by Javelle and Timmermans, [94]. 5′-end DIG-labeled oligo-probes (Additional file 1: Table S10) with sequences complementary to miR159, GAMYBL1, PMEI, cystatin, and murine miR122a (as a negative control) were synthesized by Eastport (Eastport, Czech Republic). Probe concentration of 10 nM and hybridization temperature of 50 °C were experimentally identified as optimums. In situ localization signals were detected in colorimetric reactions using DIG-specific antibody coupled to alkaline phosphatase.

Experimental design and statistical analysis

The experiments were arranged in a completely randomized design with three biological replications. Data were subjected to analysis of the variance (ANOVA) and duncan new multiple range test (DNMRT p = 0.05) for comparison of the means using the SAS software version 9.2.

Declarations

Acknowledgments

We thank Renata Plotzová and Věra Chytilová for their excellent technical assistance. We thank Vipen K. Sawhney (University of Saskatchewan, Canada) for providing the seeds of 7B-1 mutant. We thank the bioinformatics team at ScienceVision Sdn Bhd (Malaysia) for their technical advises. We thank J. Nauš (Department of Physics, Palacky University in Olomouc, Czech Republic) for measurements of the PFD of the lights. This work was supported by the Operational Programs Education for Competitiveness-European Social Fund, project no. CZ.1.07/2.3.00/30.0004 to MF, and by Ministry of Education, Youth and Sports, project no. LO1204.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Laboratory of Growth Regulators, Centre of the Region Haná for Biotechnological and Agricultural Research, Palacký University and Institute of Experimental Botany AS CR
(2)
School of Computing Sciences, University of East Anglia
(3)
School of Biological Sciences, University of East Anglia

References

  1. Sawhney VK. Genic male sterility. In: Shivanna KR Sawhney VK, editor. Pollen biotechnology for crop production and improvement. Cambridge: Cambridge University Press; 1997. p. 183–98.View ArticleGoogle Scholar
  2. Sheoran IS, Rossb A, Olsonb D, Sawhney VK. Differential expression of proteins in the wild type and 7B-1 male-sterile mutant anthers of tomato. Solanum lycopersicum), A proteomic analysis. J Proteomics. 2009;71:624–36.View ArticlePubMedGoogle Scholar
  3. Hlavinka J, Nausa J, Fellner M. Spontaneous mutation 7B-1 in tomato impairs blue light-induced stomatal opening. Plant Sci. 2013;209:75–80.View ArticlePubMedGoogle Scholar
  4. Fellner M, Zhang R, Pharis RP, Sawhney VK. Reduced de-etiolation of hypocotyl growth in a tomato mutant is associated with hypersensitivity to and high endogenous levels of abscisic acid. J Exp Bot. 2001;52:725–38.PubMedGoogle Scholar
  5. Fellner M, Sawhney VK. The 7B-1 mutant in tomato shows blue-light-specific resistance to osmotic stress and abscisic acid. Planta. 2002;214:675–82.View ArticlePubMedGoogle Scholar
  6. Bergougnoux V, Zalabak D, Jandova M, Novak O, Wiese-Klinkenberg A, Fellner M. Effect of blue light on endogenous isopentenyladenine and endoreduplication during photomorphogenesis and de-etiolation of tomato. Solanum lycopersicum L. seedlings. PLoS One. 2012;7, e45255.PubMed CentralView ArticlePubMedGoogle Scholar
  7. Sawhney VK. Photoperiod-sensitive male-sterile mutant in tomato and its potential use in hybrid seed production. J Hortic Sci Biotechnol. 2004;79:138–41.Google Scholar
  8. Dalmay T, Hamilton A, Rudd S, Angell S, Baulcombe D. An RNA-dependent RNA polymerase is required for posttranscriptional gene silencing mediated by a transgene but not by a virus. Cell. 2000;101:543–53.View ArticlePubMedGoogle Scholar
  9. Vazquez F, Gasciolli V, Crete P, Vaucheret H. The nuclear dsRNA binding protein HYL1 is required for microRNA accumulation and plant development but not posttranscriptional transgene silencing. Curr Biol. 2004;14:346–51.View ArticlePubMedGoogle Scholar
  10. Lu C, Kulkarni K, Souret FF, et al. MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant. Genome Res. 2006;16:1276–88.PubMed CentralView ArticlePubMedGoogle Scholar
  11. Borsani O, Zhu J, Verslues PE, Sunkar R, Zhu JK. Endogenous siRNAs derived from a pair of natural cis-antisense transcripts regulate salt tolerance in Arabidopsis. Cell. 2005;123:1279–91.PubMed CentralView ArticlePubMedGoogle Scholar
  12. Volpe TA, Kidner C, Hall IM, Teng G, Grewal SI, Martienssen RA. Regulation of heterochromatic silencing and histone H3 lysine-9 methylation by RNAi. Science. 2002;297:1833–7.View ArticlePubMedGoogle Scholar
  13. Fei Q, Xia R, Meyers BC. Phased secondary small interfering RNAs in posttranscriptional regulatory networks. Plant Cell. 2013;25:2400–15.PubMed CentralView ArticlePubMedGoogle Scholar
  14. Allen E, Xie Z, Gustafson AM, Carrington JC. microRNA-directed phasing during trans-acting siRNA biogenesis in plants. Cell. 2005;121:207–21.View ArticlePubMedGoogle Scholar
  15. Yoshikawa M, Peragine A, Park MY, Poethig RS. A pathway for the biogenesis of trans-acting siRNAs in Arabidopsis. Gene Dev. 2005;19:2164–75.PubMed CentralView ArticlePubMedGoogle Scholar
  16. Rajagopalan R, Vaucheret H, Trejo J, Bartel DP. A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana. Gene Dev. 2006;20:3407–25.PubMed CentralView ArticlePubMedGoogle Scholar
  17. Xia R, Zhu H, An YQ, Beers EP, Liu Z. Apple miRNAs and tasiRNAs with novel regulatory networks. Genome Biol. 2012;13:R47.PubMed CentralView ArticlePubMedGoogle Scholar
  18. Guilfoyle TJ, Hagen G. Auxin response factors. Curr Opin Plant Biol. 2007;10:453–60.View ArticlePubMedGoogle Scholar
  19. Li F, Orban R, Baker B. SoMART a web server for plant miRNA tasiRNA and target gene analysis. Plant J. 2012;70:891–901.View ArticlePubMedGoogle Scholar
  20. Axtell MJ. Classification and comparison of small RNAs from plants. Annu Rev Plant Biol. 2013;2012(64):137–59.View ArticleGoogle Scholar
  21. Jones-Rhoades MW, Bartel DP. Computational identification of plant microRNAs and their targets including a stress-induced miRNA. Mol Cell. 2004;14:787–99.View ArticlePubMedGoogle Scholar
  22. Ori N, Cohen AR, Etzioni A, et al. Regulation of LANCEOLATE by miR319 is required for compound-leaf development in tomato. Nat Genet. 2007;39:787–91.View ArticlePubMedGoogle Scholar
  23. Sun G. MicroRNAs and their diverse functions in plants. Plant Mol Biol. 2011;18:17–36.Google Scholar
  24. Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, et al. Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening. Genome Res. 2008;18:1602–9.PubMed CentralView ArticlePubMedGoogle Scholar
  25. Mohorianu I, Schwach F, Jing R, Lopez-Gomollon S, Moxon S, Szittya G, et al. Profiling of short RNAs during fleshy fruit development reveals stage-specific sRNAome expression patterns. Plant J. 2011;67:232–46.View ArticlePubMedGoogle Scholar
  26. Zuo J, Zhu B, Fu D, Zhu Y, Ma Y, Chi L, et al. Sculpting the maturation softening and ethylene pathway, the influences of microRNAs on tomato fruits. BMC Genomics. 2012;13:7.PubMed CentralView ArticlePubMedGoogle Scholar
  27. Karlova R, van Haarst JC, Maliepaard C, van de Geest H, Bovy AG, Lammers M, et al. Identification of microRNA targets in tomato fruit development using high-throughput sequencing and degradome analysis. J Exp Bot. 2013;64:1863–78.PubMed CentralView ArticlePubMedGoogle Scholar
  28. Wei M, Wei H, Wu M, Song M, Zhang J, Yu J, et al. Comparative expression profiling of miRNA during anther development in genetic male sterile and wild type cotton. BMC Plant Biol. 2013;13:66.PubMed CentralView ArticlePubMedGoogle Scholar
  29. Zhang Y, Yin Z, Feng X, Shen F. Differential expression of microRNAs between 21A genetic male sterile line and its maintainer line in cotton. Gossypium hirsutum L. J Plant Studies 2014a, DOI, 105539/jpsv3n1p13.Google Scholar
  30. Jiang J, Jiang J, Yang Y, Cao J. Identification of microRNAs potentially involved in male sterility of Brassica campestris ssp chinensis using microRNA array and quantitative RT-PCR assays. Cell Mol Biol Lett. 2013;18:416–32.View ArticlePubMedGoogle Scholar
  31. Wu MF, Tian Q, Reed JW. Arabidopsis microRNA167 controls patterns of ARF6 and ARF8 expression and regulates both female and male reproduction. Development. 2006;133:4211–8.View ArticlePubMedGoogle Scholar
  32. Palatnik JF, Wollmann H, Schommer C, et al. Sequence and expression differences underlie functional specialization of Arabidopsis microRNAs miR159 and miR319. Dev Cell. 2007;13:115–25.View ArticlePubMedGoogle Scholar
  33. Glazinska P, Zienkiewicz A, Wojciechowski W, Kopcewicz J. The putative miR172 target gene APETALA2-like is involved in the photoperiodic flower induction of Ipomoea nil. J Plant Physiol. 2009;166:1801–13.View ArticlePubMedGoogle Scholar
  34. Murray F, Kalla R, Jacobsen JV, Gubler F. A role for HvGAMYB in anther development. Plant J. 2003;33:481–91.View ArticlePubMedGoogle Scholar
  35. Kaneko M, Inukai Y, Ueguchi-Tanaka M, et al. Loss-of function mutations of the rice GAMYB gene impair alpha-amylase expression in aleurone and flower development. Plant Cell. 2004;16:33–44.PubMed CentralView ArticlePubMedGoogle Scholar
  36. Achard P, Herr A, Baulcombe DC, Harberd NP. Modulation of floral development by a gibberellin-regulated microRNA. Development. 2004;131:3357–65.View ArticlePubMedGoogle Scholar
  37. Ru P, Xu L, Ma H, Huang H. Plant fertility defects induced by the enhanced expression of microRNA167. Cell Res. 2006;16:457–65.View ArticlePubMedGoogle Scholar
  38. Zhu D, Deng XW. A non-coding RNA locus mediates environment-conditioned male sterility in rice. Cell Res. 2012;22:791–2.PubMed CentralView ArticlePubMedGoogle Scholar
  39. Szittya G, Moxon S, Santos DM, Jing R, Fevereiro MP, Moulton V, et al. High-throughput sequencing of Medicago truncatula short RNAs identifies eight new miRNA families. BMC Genomics. 2008;9:593.PubMed CentralView ArticlePubMedGoogle Scholar
  40. Jagadeeswaran G, Nimmakayala P, Zheng Y, Gowdu K, Reddy UK, Sunkar R. Characterization of the small RNA component of leaves and fruits from four different cucurbit species. BMC Genomics. 2012;13:329.PubMed CentralView ArticlePubMedGoogle Scholar
  41. Cao X, Wu Z, Jiang F, Zhou R, Yang Z. Identification of chilling stress-responsive tomato microRNAs and their target genes by high-throughput sequencing and degradome analysis. BMC Genomics. 2014;15:1130.PubMed CentralView ArticlePubMedGoogle Scholar
  42. Aryal R, Jagadeeswaran G, Zheng Y, Yu Q, Sunkar R, Ming R. Sex specific expression and distribution of small RNAs in papaya. BMC Genomics. 2014;15:20.PubMed CentralView ArticlePubMedGoogle Scholar
  43. Pantaleo V, Szittya G, Moxon S, Miozzi L, Moulton V, Dalmay T, et al. Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis. Plant J. 2010;62:960–76.PubMedGoogle Scholar
  44. Yang J, Liu X, Xu B, Zhao N, Yang X, Zhang M. Identification of miRNAs and their targets using high-throughput sequencing and degradome analysis in cytoplasmic male-sterile and its maintainer fertile lines of Brassica juncea. BMC Genomics. 2013;14:9.PubMed CentralView ArticlePubMedGoogle Scholar
  45. Schwach F, Moxon S, Moulton V, Dalmay T. Deciphering the diversity of small RNAs in plants, the long and short of it. Brief Funct Genomics. 2009;8:472–81.View ArticleGoogle Scholar
  46. Moxon S, Schwach F, Dalmay T, Maclean D, Studholme DJ, Moulton V. A toolkit for analyzing large-scale plant small RNA datasets. Bioinformatics. 2008;24:2252–3.View ArticlePubMedGoogle Scholar
  47. Stocks MB, Moxon S, Mapleson D, Woolfenden HC, Mohorianu I, Folkes L, et al. sRNA workbench, a suite of tools for analyzing and visualizing next generation sequencing microRNA and small RNA datasets. Bioinformatics. 2012;28:2059–61.PubMed CentralView ArticlePubMedGoogle Scholar
  48. Mortazavi A, Williams BA, McCue K, Schaeffer L, Wold B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat Methods. 2008;5:621–8.View ArticlePubMedGoogle Scholar
  49. Kasschau KD, Xie Z, Allen E, Liave C, Chapman EJ, Krizan KA, et al. P1/HC-Pro a viral suppressor of RNA silencing interferes with Arabidopsis development and miRNA function. Dev Cell. 2003;4:205–17.View ArticlePubMedGoogle Scholar
  50. Jones-Rhoades MW, Bartel DP, Bartel B. MicroRNAs and their regulatory roles in plants. Annu Rev Plant Biol. 2006;57:19–53.View ArticlePubMedGoogle Scholar
  51. Yang F, Liang G, Liu D, Yu D. Arabidopsis miR396 mediates the development of leaves and flowers in transgenic tobacco. Plant Biol. 2009;52:475–81.View ArticleGoogle Scholar
  52. Fu C, Sunkar R, Zhou C, et al. Overexpression of miR156 in switchgrass. Panicum virgatum L. results in various morphological alterations and leads to improved biomass production. Plant Biotechnol J. 2012;10:443–52.PubMed CentralView ArticlePubMedGoogle Scholar
  53. Sablowski RWM, Meyerowitz EM. A homolog of NO APICAL MERISTEM is an immediate target of the floral homeotic genes APETALA3/PISTILLATA. Cell. 1998;92:93–103.View ArticlePubMedGoogle Scholar
  54. Peskan-Berghofer T, Neuwirth J, Kusnetsov V, Oelmuller R. Suppression of heterotrimeric G-protein b-subunit affects anther shape pollen development and inflorescence architecture in tobacco. Planta. 2005;220:737–46.View ArticlePubMedGoogle Scholar
  55. Millar AA, Gubler F. The Arabidopsis GAMYB-like genes MYB33 and MYB65 are microRNA-regulated genes that redundantly facilitate anther development. Plant Cell. 2005;17:705–21.PubMed CentralView ArticlePubMedGoogle Scholar
  56. Murmu J, Bush MJ, DeLong C, et al. Arabidopsis bZIP transcription factors TGA9 and TGA10 interact with floral glutaredoxins ROXY1 and ROXY2 and are redundantly required for anther development. Plant Physiology 2010, doi:101104/pp110159111.Google Scholar
  57. Shao SQ, Li BY, Zhang ZT, Zhou Y, Jiang J, Li XB. Expression of a cotton MADS-box gene is regulated in anther development and in response to phytohormone signaling. J Genet Genomics. 2010;37:805–16.View ArticlePubMedGoogle Scholar
  58. Xing S, Salinas M, Hohmann S, Berndtgen R, Huijsera P. MiR156-targeted and nontargeted SBP-box transcription factors act in concert to secure male fertility in Arabidopsis. Plant Cell. 2010;22:3935–50.PubMed CentralView ArticlePubMedGoogle Scholar
  59. Xing L, Li Z, Khalil R, Ren Z, Yang Y. Functional identification of a novel F-box/FBA gene in tomato. Physiol Plant. 2012;144:161–8.View ArticlePubMedGoogle Scholar
  60. Zhu L, Shi J, Zhao G, Zhang D, Liang W. Post-meiotic deficient anther1. PDA1 encodes an ABC transporter required for the development of anther cuticle and pollen exine in rice. J Plant Biol. 2013;56:59–68.View ArticleGoogle Scholar
  61. Yang SL, Jiang L, Puah CS, Xie L, Zhang XQ, Chen LQ, et al. Overexpression of TAPETUM DETERMINANT1 alters the cell fates in the Arabidopsis carpel and tapetum via genetic interaction with EXCESS MICROSPOROCYTES1/EXTRA SPOROGENOUS CELLS1. Plant Physiol. 2005;139:186–91.PubMed CentralView ArticlePubMedGoogle Scholar
  62. Li N, Zhang DS, Liu HS, et al. The rice tapetum degeneration retardation gene is required for tapetum degradation and anther development. Plant Cell. 2006;18:2999–3014.PubMed CentralView ArticlePubMedGoogle Scholar
  63. Xu J, Yang C, Yuan Z, Zhang D, Gondwe MY, Ding Z, et al. The ABORTED MICROSPORES regulatory network is required for postmeiotic male reproductive development in Arabidopsis thaliana. Plant Cell. 2010;22:91–107.PubMed CentralView ArticlePubMedGoogle Scholar
  64. Morohashi K, Minami M, Takase H, Hotta Y, Hiratsuka K. Isolation and characterization of a novel GRAS gene that regulates meiosis-associated gene expression. J Biol Chem. 2003;278:20865–73.View ArticlePubMedGoogle Scholar
  65. Zhou S, Wang Y, Li W, et al. Pollen semi-sterility1 encodes a kinesin-1–like protein important for male meiosis anther dehiscence and fertility in rice. Plant Cell. 2011;23:111–29.PubMed CentralView ArticlePubMedGoogle Scholar
  66. Cheng Y, Wang Q, Li Z, et al. Cytological and comparative proteomic analyses on male sterility in Brassica napus L induced by the chemical hybridization agent monosulphuron ester sodium. PLoS One. 2013;8, e80191.PubMed CentralView ArticlePubMedGoogle Scholar
  67. Phan TD, Bo W, West G, Lycett GW, Tucker GA. Silencing of the major salt-dependent isoform of pectinesterase in tomato alters fruit softening. Plant Physiol. 2007;144:1960–7.PubMed CentralView ArticlePubMedGoogle Scholar
  68. Schwab R, Palatnik JF, Riester M, Schommer C, Schmid M, Weigel D. Specific effects of microRNAs on the plant transcriptome. Dev Cell. 2005;8:517–27.View ArticlePubMedGoogle Scholar
  69. Tsuji H, Aya K, Ueguchi-Tanaka M, et al. GAMYB controls different sets of genes and is differentially regulated by microRNA in aleurone cells and anthers. Plant J. 2006;47:427–44.View ArticlePubMedGoogle Scholar
  70. Gong X, Bewley DJ. A GAMYB-like gene in tomato and its expression during seed germination. Planta. 2008;228:563–72.View ArticlePubMedGoogle Scholar
  71. Reid JB, Ross JJ, Swain SM. Internode length in Pisum, A new slender mutant with elevated levels of C19 gibberellins. Planta. 1992;188:462–7.View ArticlePubMedGoogle Scholar
  72. Jacobsen JV, Olszewski NE. Mutation at the SPINDLY locus of Arabidopsis alters gibberellin signal transduction. Plant Cell. 1993;5:887–96.PubMed CentralView ArticlePubMedGoogle Scholar
  73. Ross JJ, Murfet IC, Reid JB. Gibberellin mutants. Physiol Plant. 1997;100:550–60.View ArticleGoogle Scholar
  74. Hong SH, Kim SJ, Ryu JS, Choi H, Jeong S, Shin J, et al. CRY1 inhibits COP1-mediated degradation of BIT1 a MYB transcription factor to activate blue light-dependent gene expression in Arabidopsis. Plant J. 2008;55:361–71.View ArticlePubMedGoogle Scholar
  75. Kwon Y, Kim JH, Nguyen HN, Jikumaru Y, Kamiya Y, Hong SW, et al. A novel Arabidopsis MYB-like transcription factor MYBH regulates hypocotyl elongation by enhancing auxin accumulation. J Exp Bot. 2013;64:3911–22.PubMed CentralView ArticlePubMedGoogle Scholar
  76. Liu N, Wu S, Houten JV, Wang Y, Ding B, Fei Z, et al. Down-regulation of AUXIN RESPONSE FACTORS 6 and 8 by microRNA 167 leads to floral development defects and female sterility in tomato. J Exp Bot. 2014;65:2507–20.PubMed CentralView ArticlePubMedGoogle Scholar
  77. Nagpal P, Ellis CM, Weber H, et al. Auxin response factors ARF6 and ARF8 promote jasmonic acid production and flower maturation. Development. 2005;132:4107–18.View ArticlePubMedGoogle Scholar
  78. Tian C, Muto H, Higuchi K, Matamura T, Tatematsu K, Koshiba T, et al. Disruption and overexpression of Auxin Response Factor 8 gene of Arabidopsis affect hypocotyl elongation and root growth habit indicating its possible involvement in auxin homeostasis in light condition. Plant J. 2004;40:333–43.View ArticlePubMedGoogle Scholar
  79. Rhee SY, Somerville CR. Tetrad pollen formation in quartet mutants of Arabidopsis thaliana is associated with persistence of pectic polysaccharides of the pollen mother cell wall. Plant J. 1998;15:79–88.View ArticlePubMedGoogle Scholar
  80. Lou P, Kang J, Zhang G, Bonnema G, Fang Z, Wang X. Transcript profiling of a dominant male sterile mutant. Ms-cd1, in cabbage during flower bud development. Plant Sci. 2007;172:111–9.View ArticleGoogle Scholar
  81. Dong X, Feng H, Xu M, Lee J, Kim YK, Lim YP, et al. Comprehensive analysis of genic male sterility-related genes in Brassica rapa using a newly developed Br300K Oligomeric Chip. PLoS One. 2013;8, e72178.PubMed CentralView ArticlePubMedGoogle Scholar
  82. Rhee SY, Osborne E, Poindexter PD, Somerville CR. Microspore separation in the quartet 3 mutants of Arabidopsis is impaired by a defect in a developmentally regulated polygalacturonase required for pollen mother cell wall degradation. Plant Physiol. 2003;133:1170–80.PubMed CentralView ArticlePubMedGoogle Scholar
  83. Derbyshire P, McCann MC, Roberts K. Restricted cell elongation in Arabidopsis hypocotyls is associated with a reduced average pectin esterification level. BMC Plant Biol. 2007;7:31.PubMed CentralView ArticlePubMedGoogle Scholar
  84. Al-Qsous S, Carpentie E, Klein-Eude D, Burel C, Mareck A, Dauchel H, et al. Identification and isolation of a pectin methylesterase isoform that could be involved in flax cell wall stiffening. Planta. 2004;219:369–78.View ArticlePubMedGoogle Scholar
  85. Xiao C, Somerville C, Anderson CT. POLYGALACTURONASE INVOLVED IN EXPANSION1 functions in cell elongation and flower development in Arabidopsis. Plant Cell. 2014;26:1018–35.PubMed CentralView ArticlePubMedGoogle Scholar
  86. Zhang XM, Wang Y, Lv XM, Li H, Sun P, Lu H, et al. NtCP56 a new cysteine protease in Nicotiana tabacum L, involved in pollen grain development. J Exp Bot. 2009;60:1569–77.PubMed CentralView ArticlePubMedGoogle Scholar
  87. Zheng R, Yue S, Xu X, Liu J, Xu Q, Wang X, et al. Proteome analysis of the wild and YX-1 male sterile mutant anthers of wolfberry (Lycium barbarum L.). PLoS One. 2012;7, e41861.PubMed CentralView ArticlePubMedGoogle Scholar
  88. Zhang D, Liu D, Lv X, Wang Y, Xun Z, Liu Z, et al. The cysteine protease CEP1 a key executor involved in tapetal programmed cell death regulates pollen development in Arabidopsis. Plant Cell. 2014;26:72939–61.Google Scholar
  89. Minic Z, Jamet E, San-Clement H, et al. Transcriptomic analysis of Arabidopsis developing stems, a close-up on cell wall genes. BMC Plant Biol. 2009;9:6.PubMed CentralView ArticlePubMedGoogle Scholar
  90. Prufer K, Stenzel U, Dannemann M, Green RE, Lachmann M, Kelso J. PatMaN, rapid alignment of short sequences to large databases. Bioinformatics. 2008;24:1530–1.PubMed CentralView ArticlePubMedGoogle Scholar
  91. Kozomara A, Griffiths-Jones S. miRBase, integrating microRNA annotation and deep-sequencing data. Nucleic Acids Res. 2011;39:152–7.View ArticleGoogle Scholar
  92. Bonnet E, Wuyts J, Rouzé P, Van de Peer Y. Evidence that microRNA precursors, unlike other non-coding RNAs, have lower folding free energies than random sequences. Bioinformatics. 2004;20:2911–7.View ArticlePubMedGoogle Scholar
  93. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)). Methods. 2001;25:402–8.View ArticlePubMedGoogle Scholar
  94. Javelle M, Timmermans MCP. In situ localization of small RNAs in plants by using LNA probes. Nat Protoc. 2012;7:533–41.View ArticlePubMedGoogle Scholar

Copyright

© Omidvar et al. 2015

Advertisement